Clone Read LE_HBa0218C03_T7_394186

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0218C03_T7_394186
Primer
T7
ID from Seq. Facility
LE_HBa_218_C03-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
758 trimmed for vector and quality, 899 raw
Sequence
>LE_HBa0218C03_T7_394186 (raw untrimmed)
GACGGGGATCTCTGAGTCGACTGCAGGCATGCAAGCTTATCTAACCAACTGTAGTAACCAAAATAAGACTATTACTATCTAATATCGATGCAAAACAACA
ATAAGCATGGTCGATCATGGACTAGACCATCCCAACATAGGATGGAAGCCCAGTATCGCTAGGCAAATCTAGTCATACCAGAGAGAGTTCACAAAATGGG
CAATAGACATCACGATACTATATTCACAGGCAATTGCATCATAATGTAGTCGTAAGTTGCTGAAATTTTAACATATACGGCCAGGATTGACCTGAATGTA
GTAGTTTTAGTAAACAATTAAGAAATCAAACAATTACTTGATATAAATAGAAGCTAACCAGTAGTCGTTATCAAATAGGTGTCTTGACAAGGCAGCCATT
CTTGATGACTCTGCAGCTGCAAATGAGAATAGCAAGAATCGTTGGATAGTTTCAACAGTTACAGAAGTCGAAGAAGTGAAAATGGTGCTCAAATTGATTC
CCATATGGTCCACATGCATACTTTTTTGGACAGTATACTCTCAGATGAATACCTTCACCATTGAACAAGCTACCTTCATGAACCGGAATGTTGGAAACTT
TGCTGTCCCTGCAGGTTCCTTATCCGTGTTTCTCTTTATTAGCATACTTCTGTTTACTTCCATAAACGAAAGGGTCACAGTTCGTATTGCCAGAAAAATC
ACTCACAACAGCCAAGGAATCACAAGCCTTCAGAGAGTTGGAATTGGACTACTACTCTCTATTGTTGGTATGGTAGCTTCAGCTCTGGTAGAAAAACGAC
GAAGGGAACATGCCATCCATCATAACTTCAAGATAAGCGCGTTTTGGTTAGTGCCTCAATTCTTCATTGTAGGTGCTGGGGAAGCTTTTGCCTAAGTAG
>LE_HBa0218C03_T7_394186 (trimmed for quality and cloning vector)
CTGCAGGCATGCAAGCTTATCTAACCAACTGTAGTAACCAAAATAAGACTATTACTATCTAATATCGATGCAAAACAACAATAAGCATGGTCGATCATGG
ACTAGACCATCCCAACATAGGATGGAAGCCCAGTATCGCTAGGCAAATCTAGTCATACCAGAGAGAGTTCACAAAATGGGCAATAGACATCACGATACTA
TATTCACAGGCAATTGCATCATAATGTAGTCGTAAGTTGCTGAAATTTTAACATATACGGCCAGGATTGACCTGAATGTAGTAGTTTTAGTAAACAATTA
AGAAATCAAACAATTACTTGATATAAATAGAAGCTAACCAGTAGTCGTTATCAAATAGGTGTCTTGACAAGGCAGCCATTCTTGATGACTCTGCAGCTGC
AAATGAGAATAGCAAGAATCGTTGGATAGTTTCAACAGTTACAGAAGTCGAAGAAGTGAAAATGGTGCTCAAATTGATTCCCATATGGTCCACATGCATA
CTTTTTTGGACAGTATACTCTCAGATGAATACCTTCACCATTGAACAAGCTACCTTCATGAACCGGAATGTTGGAAACTTTGCTGTCCCTGCAGGTTCCT
TATCCGTGTTTCTCTTTATTAGCATACTTCTGTTTACTTCCATAAACGAAAGGGTCACAGTTCGTATTGCCAGAAAAATCACTCACAACAGCCAAGGAAT
CACAAGCCTTCAGAGAGTTGGAATTGGACTACTACTCTCTATTGTTGGTATGGTAGCT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.97093
Expected error %
0.0704767
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0218C03
Clone
Clone name
hba-218c3
LE_HBa0218C03
P218C03
Clone type
BAC
Contamination
none
Estimated length
75,797
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found