Clone Read LE_HBa0218D08_SP6_394297

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0218D08_SP6_394297
Primer
SP6
ID from Seq. Facility
LE_HBa_218_D08-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
103 trimmed for vector and quality, 888 raw
Sequence
>LE_HBa0218D08_SP6_394297 (raw untrimmed)
NNCCCGCTGCGCTGGTTTCTTCTTCTGCGACTGGTTTCCAGAGACTGCTGCCGTGAATTGATCAGAATTGTTTGAATTTTGGCACTTGGTTAACCCAAAC
CTCTACCTTCCGGTTAATGGAAATTTTAACCCTAATGGTTTCCCCTTTTGAATTACCCCCCAAATTTACCTCCGGAAAACCAGGTTAAATGAAAATAACC
TGGCCGGGTGGCCTTTAAATTGACCGGAATGGGAAAAACAAAATAGAAAGTGGTGAACCGGGTCCGAAAGGTCCTCACCTCCTCACCTAACAACCTCCTT
TTAATTCCTCCTTTTAATCCACACAAACTAAGCCTCACTGGAACCAAGTCTGCACAAAGGTTTTGGTTTCCTCTTCGTCCTCCTCTTTTTTCAGTTTAAT
CAAGCTGCTGAAACAGCTAAAAAACTTAACTTATATGGGATTGTTGTGATTGGTGGAGATGATTCAAATACAAATGCTTGTCTTCTAGCTGAGAACTTTA
GGT
AAGTATTATTATTATATTGGACTGGCTCATGGTAGTCGTCATTGGCGTTCTTCTCATAGAACTTTGTTTGTTTGGTGCGAGTGAAGGGGTAAAGGTC
TGAAAACACAGGTTATTGGATGCCCCCAGACAATTGATGGTGATTTGAAATAGCAAGAAAATCCCACCCCTTTCGGATTTGATACTGCCCGCCACGGAAA
AGGTTTTCCTTTTGCCCTATTTCCAAAACAAAAATCCCCTTTTCTTCCCCTAATTTTATAAAATAAAAATAAGTAGAACATCTCCCTTGCCCCTAAATTT
TTTCTTCTTGTACAAAAACACTCCAAAAGGGGTGCCTTCCAAAATTTTATGCCAGTCGGCCTATTTCCACCGTAAGGAAAATTTACCC
>LE_HBa0218D08_SP6_394297 (trimmed for quality and cloning vector)
AAGTATTATTATTATATTGGACTGGCTCATGGTAGTCGTCATTGGCGTTCTTCTCATAGAACTTTGTTTGTTTGGTGCGAGTGAAGGGGTAAAGGTCTGA
AAA

This is probably not a useful sequence.

Problems:
  • Short cloning insert
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.930851
Expected error %
1.30964
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0218D08
Clone
Clone name
hba-218d8
LE_HBa0218D08
P218D08
Clone type
BAC
Contamination
none
Estimated length
78,284
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found