Clone Read LE_HBa0218D08_T7_394299

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0218D08_T7_394299
Primer
T7
ID from Seq. Facility
LE_HBa_218_D08-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
82 trimmed for vector and quality, 897 raw
Sequence
>LE_HBa0218D08_T7_394299 (raw untrimmed)
GTCGGGGTCTCTGAGTCGACTGCAGGCTGGCAGCTTGGAGAATGATGGATTAAATGATGATGATGATGTGCTTAAAATGGTCCAATTCCAGAAGAATGGA
GGGACTTAAACCTAATGCGATTCACCACCTCAAAATGGATGGTGATGTTCAAATCCTTATCCTCCCTGAAAAGAATGCTAAGGTTGACCAGGATGTATTG
GTCCCTGGAACTCCCTCAAACTCTCCCCGAATGTACCTCAATCCCCAAAAAAAGGAGGCACTCCTGGTAAAAAAAAAAATGGCTATTTGGCCAATCAATC
TGCGCCCAAGTCACGATGGGAACCTAGTTCCTCCCATCCCCTTGATAAACTCATTTCTCCCCTGGATTCTGGAATTCTAACTAGATCCAAAACAAGAAAT
CTAGTTGCATTCTCAGCATTCATATCATCTATTGAGCCCAAGAATGTTTAAGAAGCATTAGGTGATGCAGACTGGATCAATTCTATGCAAGAAGAACTCC
ATTAGTTTCAAAGAAGTAAGGTATGGTACCTGGTTCCTCCA
CCTGATTGCAGAACAATAATAGGAACTAGGTAGGTATTCAGAAACAAACTTGATGAAAA
TGGAGTGATTACTATAAATAAATCCAGGCTGGTGGTGCGAGGATACAATTAAAAAGAAGGAAATGACTATGATGAGACTTTTGTCCCTGTTGCCCGAATG
GAAGCTATTTGAATCTTAATAACTTTTGCTGCTTTTTTGGGGTTCGAGCCGCATCCAATAAATGTGAAAAAAGGCTTTCTTAATGGGGATCCCCAAATGA
GGGGTGTGTGAGGCACCCCCCGGTTTTGAAAATCAAACTACCAACCTTGGTTTCGATTGATAAAGACTATAGGGCTGAAAAACTCCCAAACCAGGTT
>LE_HBa0218D08_T7_394299 (trimmed for quality and cloning vector)
CCTGATTGCAGAACAATAATAGGAACTAGGTAGGTATTCAGAAACAAACTTGATGAAAATGGAGTGATTACTATAAATAAAT

This is probably not a useful sequence.

Problems:
  • Short cloning insert
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.835552
Expected error %
0.819799
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0218D08
Clone
Clone name
hba-218d8
LE_HBa0218D08
P218D08
Clone type
BAC
Contamination
none
Estimated length
78,284
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found