Clone Read LE_HBa0235M14_SP6_394406

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0235M14_SP6_394406
Primer
SP6
ID from Seq. Facility
LE_HBa_235_M14-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
714 trimmed for vector and quality, 889 raw
Sequence
>LE_HBa0235M14_SP6_394406 (raw untrimmed)
NNCCAATTAGTATTGATCCTTTAGAATTGTCCGAATATGTATTATTGATTGGTGTGGTCTTATCCTTTTGGATAAAGCTTTTCAAAGTAAATTGCGTACC
TGTACGTATTGTCCCTTTTCTTAGCATGATTTCATGATATGTGTGCATATGGTCTCCTACTTGGTACAAGTGGTGTACTAACCCTATTTTCTCCCTTTTC
CCCAACATTTTATGTTCCGGTCGTTGAAGGGCTTTGGGACGACTTTTAAGAAGGCTTGGAATTCTCAATCATACAAGTTGGGTAGGTCCTCACTCTCTAA
GGGCAATGTCAATATCAATCTTATTAAGTTATTCTAGTTTTAAGACTCTTCTGTTCTTTCCTTTTCTTTGAATACTAAACATTGTATGGCCTATATGTGG
TCTTGTTATATTGATGTATGGTCTAGGCCCAAGTTATTATACTCTTGTTAGATGGTTATGAGATGAGACGTCCATTTGAGACTATGTTATATTCTATATA
TCTCTGTGCAATAAAAGTAGAAGACTAAGTAATCTTACTATACGAAGGGTCTATGTATACTCGATATAAATATTATGTGTATGTAGAGGTCTATGTAAAC
CTCCATGTAGAAGTAATGAAAAAGTTTAAAAATGTTCCGTACTTTTAAATTATTAATGTAATGATGTAAGCTAAAAGACTAGTCTTAGTCCTCAAAGAGG
ACAACGACGCCCGGTATGTCAAGGGGTGCTCCCCGGATGTGATACTTAAAAATAAGGACAACCTACGTCTTAGTCCATTTCCTATATTGAGATGAATATG
TGGGGAATGGGTTTAGGAATTCCTCTCTCCTGAGCTGAACCCTGATAACCCAAAACCAATAAATAATCATTCAATAAATCTTGAATTTA
>LE_HBa0235M14_SP6_394406 (trimmed for quality and cloning vector)
ATTGTCCGAATATGTATTATTGATTGGTGTGGTCTTATCCTTTTGGATAAAGCTTTTCAAAGTAAATTGCGTACCTGTACGTATTGTCCCTTTTCTTAGC
ATGATTTCATGATATGTGTGCATATGGTCTCCTACTTGGTACAAGTGGTGTACTAACCCTATTTTCTCCCTTTTCCCCAACATTTTATGTTCCGGTCGTT
GAAGGGCTTTGGGACGACTTTTAAGAAGGCTTGGAATTCTCAATCATACAAGTTGGGTAGGTCCTCACTCTCTAAGGGCAATGTCAATATCAATCTTATT
AAGTTATTCTAGTTTTAAGACTCTTCTGTTCTTTCCTTTTCTTTGAATACTAAACATTGTATGGCCTATATGTGGTCTTGTTATATTGATGTATGGTCTA
GGCCCAAGTTATTATACTCTTGTTAGATGGTTATGAGATGAGACGTCCATTTGAGACTATGTTATATTCTATATATCTCTGTGCAATAAAAGTAGAAGAC
TAAGTAATCTTACTATACGAAGGGTCTATGTATACTCGATATAAATATTATGTGTATGTAGAGGTCTATGTAAACCTCCATGTAGAAGTAATGAAAAAGT
TTAAAAATGTTCCGTACTTTTAAATTATTAATGTAATGATGTAAGCTAAAAGACTAGTCTTAGTCCTCAAAGAGGACAACGACGCCCGGTATGTCAAGGG
GTGCTCCCCGGATG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.957179
Expected error %
0.717335
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0235M14
Clone
Clone name
hba-235m14
LE_HBa0235M14
P235M14
Clone type
BAC
Contamination
none
Estimated length
87,679
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found