Clone Read LE_HBa0218E22_SP6_394442

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0218E22_SP6_394442
Primer
SP6
ID from Seq. Facility
LE_HBa_218_E22-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
765 trimmed for vector and quality, 841 raw
Sequence
>LE_HBa0218E22_SP6_394442 (raw untrimmed)
TTTCCGATGATAGTTATTCAGTAGACTTGGTTGTCTTCCTAGATTCGAGAACATCATGATGTTTAGATTTCCTTATTGAAAGTATTATAATAGAGTTAGC
TATTTTCTATACATTGAAGTATGGGTCGTGTCCTAATTTATTCGTATATCTAAGATGGTGACTTTAAGACATAGCCTTTAATTATGTTTTTATATAAAAG
AGATATTTTGAAGTATTATTATTCTGTGTGAAAAAATTTAATTCCGCACTACTTTTCATACATATATTTAATCAATGATGTGTAAGGGCTTGTACAAGAC
CTCATGAGAGGTCAAGTGTAGTGTGTATCGATTTAAGTGTGCCTTATCTTTTAGGAGATACTTTGGGTCCTTAAAAACTTTGTAATAGAGAATAAGGTTT
TGAAGGAGTACTTAGGAATCAAAAGGTCTCAAAAATACCTATCTAGTAAGTCTTTTTTATTGATTGAGTCACAACACATCCATGAGCTAGAGGCTATTGG
ACGATAGAGTTTCACTTTTTCTCTACGATTGTGTCATGCCGTAGAGCTTAAATTTATACGCGTCCTTTCTTAATGTTTCCTATTATGTTTATAGGACATG
AAAAAGAAAAGGACACCGACTAGTAGGGTTCATAAGGAGGTGCTTATTGGGGAAGTTCCTCCCCGAGTTGAGCATGTTGAGCATGTGATTAAGTTAATAA
AGACAATCAAATTCCTCCACAAGGTGATCAAATTCCTATAAAAGGTGGAGGTAATGAGATTTTGGTGGTTCCGCTTGTTATGGCTAGTGGGTATATTAGA
GAGACTCTCCTTACTCTAGCCTGATATTTGACTACACAAGT
>LE_HBa0218E22_SP6_394442 (trimmed for quality and cloning vector)
TGTCTTCCTAGATTCGAGAACATCATGATGTTTAGATTTCCTTATTGAAAGTATTATAATAGAGTTAGCTATTTTCTATACATTGAAGTATGGGTCGTGT
CCTAATTTATTCGTATATCTAAGATGGTGACTTTAAGACATAGCCTTTAATTATGTTTTTATATAAAAGAGATATTTTGAAGTATTATTATTCTGTGTGA
AAAAATTTAATTCCGCACTACTTTTCATACATATATTTAATCAATGATGTGTAAGGGCTTGTACAAGACCTCATGAGAGGTCAAGTGTAGTGTGTATCGA
TTTAAGTGTGCCTTATCTTTTAGGAGATACTTTGGGTCCTTAAAAACTTTGTAATAGAGAATAAGGTTTTGAAGGAGTACTTAGGAATCAAAAGGTCTCA
AAAATACCTATCTAGTAAGTCTTTTTTATTGATTGAGTCACAACACATCCATGAGCTAGAGGCTATTGGACGATAGAGTTTCACTTTTTCTCTACGATTG
TGTCATGCCGTAGAGCTTAAATTTATACGCGTCCTTTCTTAATGTTTCCTATTATGTTTATAGGACATGAAAAAGAAAAGGACACCGACTAGTAGGGTTC
ATAAGGAGGTGCTTATTGGGGAAGTTCCTCCCCGAGTTGAGCATGTTGAGCATGTGATTAAGTTAATAAAGACAATCAAATTCCTCCACAAGGTGATCAA
ATTCCTATAAAAGGTGGAGGTAATGAGATTTTGGTGGTTCCGCTTGTTATGGCTAGTGGGTATAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.947309
Expected error %
0.0897737
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0218E22
Clone
Clone name
hba-218e22
LE_HBa0218E22
P218E22
Clone type
BAC
Contamination
none
Estimated length
54,577
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found