Clone Read LE_HBa0218E22_T7_394444

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0218E22_T7_394444
Primer
T7
ID from Seq. Facility
LE_HBa_218_E22-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
100 trimmed for vector and quality, 940 raw
Sequence
>LE_HBa0218E22_T7_394444 (raw untrimmed)
NTTTTNNNNNNNCCTACGACGGGGATCTCTGAGTCNACTGCAGGCATGCAGCTTATCATATTTCCTGAGCATCCATGGATTCCTTCCATTCCTTTTCCCC
TTTTCCTTTCCGGAATTTTTTTTAAAAAAAAACTAATGGTATTGAATTTAATTTTTAAAAAAGAAAAATATTTTAATGGATTTTTTTTCCTACACATCCA
AATTGGGATCTGGGAGTTGTTTAACTCAGAAAAATTCTATTTTGAAATAAAAAATTGAGAAAGGGGCCATTTTAATGTCCCAAATTAACACTTCCAAATT
TTAGAATTTAGATTTTAAATATTTGACAAGATTTATCGCCGCCAATAAAATTATTGATAGTAATTTGGTTAAAAAATGTTAGTGGTGCTGCGCAAATTAT
TCACCCCCCATGGATTTTAAGAATCTTGCCGCACCAAGAGAATGGAAAACAACCAAGTTGAGGTGGAGAAGAAAGAGAAAAAGAAAGAACCTTGTTTACG
TGGAGAAGAAAGAGAAAAAAGGAAAACCACGCAATACAAAGAAATTAGATAAAAATAATTTCAAATTATTTTTAATACGTGGCAAGTGACTATTAGTACG
TAACATACAAATATTTTTGTACAAGTGGTATTGAGTGAAAAAGAGGTATACATTCTACTTTTAATTTGTTTAAAGGGGTAATAGGACACCTGCAACGTTA
AAATATCTTTCTCAAAATTCAAAAAAAACTTGAGGAGAAATCCGAGTCTTTTTTTACATAAATAAAAAAAGACACCTCCCCCTTTAACAACCAAAATTAA
TTTTTTTTGGGTGGGCGTGGCCCCCCTAACCCTAGGGGGGCAGTTGACTTGAATAAAAAATTCAATATTTAAGGATTTCCGGCTTTTTTTATCAAAACCT
TAATTCCCAAAATTCCCCTAAAGGCCCCCTAAGGCTTTTG
>LE_HBa0218E22_T7_394444 (trimmed for quality and cloning vector)
TTCCTTTTCCCCTTTTCCTTTCCGGAATTTTTTTTAAAAAAAAACTAATGGTATTGAATTTAATTTTTAAAAAAGAAAAATATTTTAATGGATTTTTTTT

This is probably not a useful sequence.

Problems:
  • Short cloning insert
  • Low complexity
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
  • Not screened for contaminants
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.685475
Expected error %
2.42862
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0218E22
Clone
Clone name
hba-218e22
LE_HBa0218E22
P218E22
Clone type
BAC
Contamination
none
Estimated length
54,577
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found