Clone Read LE_HBa0218I18_SP6_394792

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0218I18_SP6_394792
Primer
SP6
ID from Seq. Facility
LE_HBa_218_I18-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
682 trimmed for vector and quality, 870 raw
Sequence
>LE_HBa0218I18_SP6_394792 (raw untrimmed)
NNNCCGCTCTAGTTGAGTCATTCTAAAGTTAAATGTATAAGAAATTTAGCAAAGTACCGATAGACTAGCAATGAGCTTGTGCAAGCACATATAAGCCTGA
TGAGATGAGACTACCAGCAAGGTGGATAAGTATCTCAAAAATCTCCTAGTCTTTGAACTATGTTGCCCGCATGGGGAATAGCCGGTGGATTCCATCTAAG
AGAGCTAAGTGGTATTCGGTTTCACTTTGGTAGGTGTACGACCCATTTTTAGTATGGGGCAGACAGTAAATTTCGTGTTTAGCTCACACGATCTATGTTA
TTTAGTGCTCAAATAAAGTGTTTTGTTTCACTTTAGCCGTGAACTAGCTCTTTTTTGTGTGGGGAAGAAACTAGACTTGGTTTCACTTTTGCTGGTAAAC
CACCCCTTTTCAGTGTGGGATAGACACTGGATTTCATGTTAACTACATGATCAAGGTTTAAACTGATCGGTGAACCACCCCTTTCTGTTTGGAGTAGACA
CTGGATTTGATGTTAGAAAACATGATCTTAATGCTAAAGATTTCATTAATAAAGTAAGTAAGAAAGAAGAACAAATGTAAGTACAAATTTAATTAAGAAA
GAAAGAGCTTAAAGTATACAAATAATAAGTGGTTGATAAGAATGATGTTTTAATAACTTATTGTTTTATGCCAACAAAGATATATGCTCTAGTATCTTCA
CATTATGAAAATGATCAAATAGTAGGCATATCCATAAATCTTTATACTAACCAAATGATCAAATAATGGACCTTGAAAAAGATTATTTGCCAATAAAGAG
AGCAAACTTAATGACTCCATAATTCCGAGAAAAAAGAATGCCCCAACATTTTTTTTTTTTGCCAAGGTTA
>LE_HBa0218I18_SP6_394792 (trimmed for quality and cloning vector)
GTCATTCTAAAGTTAAATGTATAAGAAATTTAGCAAAGTACCGATAGACTAGCAATGAGCTTGTGCAAGCACATATAAGCCTGATGAGATGAGACTACCA
GCAAGGTGGATAAGTATCTCAAAAATCTCCTAGTCTTTGAACTATGTTGCCCGCATGGGGAATAGCCGGTGGATTCCATCTAAGAGAGCTAAGTGGTATT
CGGTTTCACTTTGGTAGGTGTACGACCCATTTTTAGTATGGGGCAGACAGTAAATTTCGTGTTTAGCTCACACGATCTATGTTATTTAGTGCTCAAATAA
AGTGTTTTGTTTCACTTTAGCCGTGAACTAGCTCTTTTTTGTGTGGGGAAGAAACTAGACTTGGTTTCACTTTTGCTGGTAAACCACCCCTTTTCAGTGT
GGGATAGACACTGGATTTCATGTTAACTACATGATCAAGGTTTAAACTGATCGGTGAACCACCCCTTTCTGTTTGGAGTAGACACTGGATTTGATGTTAG
AAAACATGATCTTAATGCTAAAGATTTCATTAATAAAGTAAGTAAGAAAGAAGAACAAATGTAAGTACAAATTTAATTAAGAAAGAAAGAGCTTAAAGTA
TACAAATAATAAGTGGTTGATAAGAATGATGTTTTAATAACTTATTGTTTTATGCCAACAAAGATATATGCTCTAGTATCTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.954608
Expected error %
0.212473
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0218I18
Clone
Clone name
hba-218i18
LE_HBa0218I18
C02HBa0218I18
P218I18
Clone type
BAC
Contamination
none
Estimated length
68,985
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found