Clone Read LE_HBa0218J05_SP6_394832

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0218J05_SP6_394832
Primer
SP6
ID from Seq. Facility
LE_HBa_218_J05-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
746 trimmed for vector and quality, 905 raw
Sequence
>LE_HBa0218J05_SP6_394832 (raw untrimmed)
TTAGCTTGATTTTTTTGAAAGGCGAATTCAGAGGAATTATAGAGATTGTAACACTCGCATTTGAAATGATAAAATCGATTGTTGCTATAATTTTCCGTTC
TTGATTATTATTTTCTCGACGTGAATTTTATTGTCTACAATTTTATATAATGCTTAAAAAATCATAAATAAGAAGACAATTATATTGATTCACCCTTATT
TTTGGAAGATTTACAAATAAATGTAAATATTTTCCAAAAAAATTAATCGCAAAGATAACATAAAAAAATTAATTAATATTTTAATATTTTTTAAATTTAT
TTAAAAGGTCATATTAATTAAAAGGGATATTTTGAGATGTTTAGTAATATTTGTTTTGTTTATAATATCTATGAATATTTTATAATTTTGTCTCTATTTT
GCTCTTGTTATTAAGTACTCCCTTTGTTCATTTTTATTTTTCACAATTTAATTTGGAACACATATTAAAAAAATAATTATTGATATAATATGTTTTACCA
AACTATGCCTATTAAACGATTTAGAAAATAAATTTTGAAAGTAATATGTAAAAATGAAAAATCTATTTTAGGAATAAGGAACAATTAAAAATGAAATTTA
TTTAGAAATAAGTGATAAGAAAGTGAAGTGGGGGAGTGCTATTCATTTTTTCATTATTTAGATGACTTGTATTTAATATAAGTAATTTGGTAAAATTATC
CTATTATTTACTACTTTTTAATTACGGTGTTAAATTAATTATAGATAACTATTGTTGGACAAAGAAGTACTAGTAATTAATTTTATCTTAATTTAGTACA
ACCGTCAAGTAATATACTCCCTCCGTCCACCTATATTTGTTAAGGTTTTTTTAGAGAGCGAACAAACAAACCTTTACAAACAATTGGAGAAAAACTTTTT
TTCAC
>LE_HBa0218J05_SP6_394832 (trimmed for quality and cloning vector)
TTTGAAAGGCGAATTCAGAGGAATTATAGAGATTGTAACACTCGCATTTGAAATGATAAAATCGATTGTTGCTATAATTTTCCGTTCTTGATTATTATTT
TCTCGACGTGAATTTTATTGTCTACAATTTTATATAATGCTTAAAAAATCATAAATAAGAAGACAATTATATTGATTCACCCTTATTTTTGGAAGATTTA
CAAATAAATGTAAATATTTTCCAAAAAAATTAATCGCAAAGATAACATAAAAAAATTAATTAATATTTTAATATTTTTTAAATTTATTTAAAAGGTCATA
TTAATTAAAAGGGATATTTTGAGATGTTTAGTAATATTTGTTTTGTTTATAATATCTATGAATATTTTATAATTTTGTCTCTATTTTGCTCTTGTTATTA
AGTACTCCCTTTGTTCATTTTTATTTTTCACAATTTAATTTGGAACACATATTAAAAAAATAATTATTGATATAATATGTTTTACCAAACTATGCCTATT
AAACGATTTAGAAAATAAATTTTGAAAGTAATATGTAAAAATGAAAAATCTATTTTAGGAATAAGGAACAATTAAAAATGAAATTTATTTAGAAATAAGT
GATAAGAAAGTGAAGTGGGGGAGTGCTATTCATTTTTTCATTATTTAGATGACTTGTATTTAATATAAGTAATTTGGTAAAATTATCCTATTATTTACTA
CTTTTTAATTACGGTGTTAAATTAATTATAGATAACTATTGTTGGA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.857945
Expected error %
0.0219621
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0218J05
Clone
Clone name
hba-218j5
LE_HBa0218J05
C02HBa0218J05
P218J05
Clone type
BAC
Contamination
none
Estimated length
107,719
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found