Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

Clone Read LE_HBa0218L13_T7_395040

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0218L13_T7_395040
Primer
T7
ID from Seq. Facility
LE_HBa_218_L13-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
617 trimmed for vector and quality, 928 raw
Sequence
>LE_HBa0218L13_T7_395040 (raw untrimmed)
NTTATGGTCGGGGTCTCTGAGTCGACCTGCAGGCATGCAAGCTTAAGAATAGTAAACATATATCTATTGTTACATTCCTATGATTCTTAAATAAAAATTT
GGAAAGTGGGGATCATCCAAGTGTATGATTATATTCTTGAATATATTACAGATTAAGAAGACATTTGGTTCGTTCGACAAGTATCTGTGGGGATTCGTGA
ACAACAAGCCCATTGCAACACAATACAAGGCATGCAACAAAATCCCAGTGAAGACTTCAAAATCAGAAACCATAAGTAAAGACATGGTCAAAAGAGGGTT
CCGCTATGTCGGCCCCACCGTTATACACTCGTTCATGCAGGCAGCCGGACTCACCAACGACCACCTGATCGCCTGTCCACGACATCTCCCGTGTGTGGCA
TTGGCAACTCAACCTGCACCCCCTGCCCTATAATTTACCTTTTATCAACTACTCTACTAAGCCATAGTTTTAAGTTTAGCAAACAAAAGTTGTTGAGGAA
ACCTAGTTGAGATTGTCTAACAATATTCTACCTTCTTCTTTTTTTTGGGGTGATGAATTTAGATGTTTTAAGTGATTTTATTTGATGATGTAAGATATTG
AGTTGGTTAAATGTATAGAAAGTAGAAAGGAATAAAGTAAGGATGGTATAGATATGGGGGGACAGGAAACATGTGCAAGGTGGGCAGGGGAATGCCAATT
GCATGTGGCATTTGATTTAATTTTGTGTGGGCACTGACCACCCTCACCATCAGCAGCAAAAACCATCACTGCACCACTATTTACTTGCACTTGCGTGCTT
TTGAAAGTGACTTATCTTTCAAGGGAAAGATTTTCCAGTTCCCAGAGGAGGAGACCTTTGTTTCCCCCCTTATTGGGCCTTTATTTCTGTGGTTGCAGGG
AAAAAAAAGGGAAGAATTTTTCCTGCCT
>LE_HBa0218L13_T7_395040 (trimmed for quality and cloning vector)
ACCTGCAGGCATGCAAGCTTAAGAATAGTAAACATATATCTATTGTTACATTCCTATGATTCTTAAATAAAAATTTGGAAAGTGGGGATCATCCAAGTGT
ATGATTATATTCTTGAATATATTACAGATTAAGAAGACATTTGGTTCGTTCGACAAGTATCTGTGGGGATTCGTGAACAACAAGCCCATTGCAACACAAT
ACAAGGCATGCAACAAAATCCCAGTGAAGACTTCAAAATCAGAAACCATAAGTAAAGACATGGTCAAAAGAGGGTTCCGCTATGTCGGCCCCACCGTTAT
ACACTCGTTCATGCAGGCAGCCGGACTCACCAACGACCACCTGATCGCCTGTCCACGACATCTCCCGTGTGTGGCATTGGCAACTCAACCTGCACCCCCT
GCCCTATAATTTACCTTTTATCAACTACTCTACTAAGCCATAGTTTTAAGTTTAGCAAACAAAAGTTGTTGAGGAAACCTAGTTGAGATTGTCTAACAAT
ATTCTACCTTCTTCTTTTTTTTGGGGTGATGAATTTAGATGTTTTAAGTGATTTTATTTGATGATGTAAGATATTGAGTTGGTTAAATGTATAGAAAGTA
GAAAGGAATAAAGTAAG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.967442
Expected error %
0.27517
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0218L13
Clone
Clone name
hba-218l13
LE_HBa0218L13
C02HBa0218L13
P218L13
Clone type
BAC
Contamination
none
Estimated length
70,493
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found