Clone Read LE_HBa0236E19_T7_395256

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0236E19_T7_395256
Primer
T7
ID from Seq. Facility
LE_HBa_236_E19-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
713 trimmed for vector and quality, 985 raw
Sequence
>LE_HBa0236E19_T7_395256 (raw untrimmed)
GATGTCGGGGATCTCTGAGTCGACCTGCAGGCATGCAAGCTTACCGCAGACAAAAGCCAAGTATTATAGTGGATAAGTAGACAAGCGGGCCAATCAAGAG
ATTTCTTGATTATAAGAAAAAGACATGCGAGATTCAAACAGGTAAACTAACACACAATATATGCATTATCAAGCAAGCCTAACTAGCTTGTAAATGAATA
TCTTAAACTTATACTAACATATATATATATATATATCAATGTATGTGTTCATCGGTTATATAGCCTAGAAGGCCAGGGTTTTTCTCCCAAAAGCCAAAGG
AGAAGACACCTTTTTCAGCCTCACTATAGGCTGCTCAACTCAAAGGGAGTCCTAACTTTTCTTTTAGAATGTTCACTCAGTAAATCTTCACATCCTTGCC
CAAATATTAATTTTCCTTAATATAATTACCCTGTAAATGTTCAAACGCTCCCCCCAATCCCACCCCTATTTCCTCTATGAGTTACCACTCTCCCGAAAGG
CTGCCACACAAAAGAGGCACAATCAATCAATTAACTATACAAACTTGGGGTCGGTTATGTGAATCCTCCTCGACCATTTTACTCAATTCTTGACTCGAAT
CATTCCAAAACTACTTCGCATAAAAATATTTTACCATATAGAAAATGAAACCTTTACAAAAATCCAATCTTTTTAAGGAGTCCAAATTAAAAAAGAACAC
CCCTTTATAGTAAATCACAGTTATAACCCAAAAAAATCAAAGATACTAAACCACATGGTTTATTAAGCAATGAAATACCTCTAAGCCTGGGTTTATAGAA
ACTAAGAGTGTCTTTCCACCTTTCCTTCTTTAAACCAATAAATGCTCTCAACCCATTGAGATACTTCCGGCCAGAATTTAACGGTTCCCTGTTGTCCCCG
CCATTGGGGTGCCCGTGCAAAAACCCTGACAAAACAAAAATTGGACCCCTTAAAACCTCCTAATTCTAACCCCCCAAAATCTAAC
>LE_HBa0236E19_T7_395256 (trimmed for quality and cloning vector)
GACCTGCAGGCATGCAAGCTTACCGCAGACAAAAGCCAAGTATTATAGTGGATAAGTAGACAAGCGGGCCAATCAAGAGATTTCTTGATTATAAGAAAAA
GACATGCGAGATTCAAACAGGTAAACTAACACACAATATATGCATTATCAAGCAAGCCTAACTAGCTTGTAAATGAATATCTTAAACTTATACTAACATA
TATATATATATATATCAATGTATGTGTTCATCGGTTATATAGCCTAGAAGGCCAGGGTTTTTCTCCCAAAAGCCAAAGGAGAAGACACCTTTTTCAGCCT
CACTATAGGCTGCTCAACTCAAAGGGAGTCCTAACTTTTCTTTTAGAATGTTCACTCAGTAAATCTTCACATCCTTGCCCAAATATTAATTTTCCTTAAT
ATAATTACCCTGTAAATGTTCAAACGCTCCCCCCAATCCCACCCCTATTTCCTCTATGAGTTACCACTCTCCCGAAAGGCTGCCACACAAAAGAGGCACA
ATCAATCAATTAACTATACAAACTTGGGGTCGGTTATGTGAATCCTCCTCGACCATTTTACTCAATTCTTGACTCGAATCATTCCAAAACTACTTCGCAT
AAAAATATTTTACCATATAGAAAATGAAACCTTTACAAAAATCCAATCTTTTTAAGGAGTCCAAATTAAAAAAGAACACCCCTTTATAGTAAATCACAGT
TATAACCCAAAAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.951938
Expected error %
0.0761126
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0236E19
Clone
Clone name
hba-236e19
LE_HBa0236E19
C12HBa0236E19
P236E19
Clone type
BAC
Contamination
none
Estimated length
85,964
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found