Clone Read LE_HBa0117B06_SP6_39610

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0117B06_SP6_39610
Primer
SP6
ID from Seq. Facility
LE_HBa_117_B06-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
307 trimmed for vector and quality, 812 raw
Genbank Accession
Sequence
>LE_HBa0117B06_SP6_39610 (raw untrimmed)
TGGGTTTCAAACTGCGGAGAAAGGGATTACGTTGGAAAATCCCTTTGAGTCTTTTACATGGAATAAATTGGATAAAGCCCAGAATCTTGGATGGGTGTTT
GCTTGGCCTGGAGTGAGAGCTGTATAAGAAAAGCCTATAAAAATCCAAAGTGCCCGTGCCCCGTGTTGCGCAGTTCAGAGTACCTGTTTCTTCTTTGCAG
CACGATTCAAGCTACAAAATCCTTTATTTCCTTATATAATACTGGATGATTGGGAAAGAACAAAATAGGTGGTATTTTGCAGGGGTTGCTTTTTCAAGAC
ATAGTCTAAGTTAACTTGCTGTTACCTTGTTTTTTTAAAAAAGTTAAAAGTCTGTTACCTTGGTATTCTTGGTGGAAAGTAGAATAAACATGAACTTAAG
ACGGATTTCACAGGGTATTCGGAGTCTGTGGCATCTGTGGAAAAGGATATTGTCTTCGTCATTCTACGGTCTAATGAGCAGATGCTGCAAAAATGAAAGC
TTTCTTGTGCTTTTCCTTTCTAGCTATTTGAGAAAAGTCCTCACACTTATCATTGAGCTCTCTATTCTGCATACAACATAATTGACCTCTTGATGAAGCC
GAGCTTAGTATAGTACAGGCAAGCTTCTGATATTTTACATTGTAATGCATATAACACTAAACAAACACTCGACTTCTTTACCCTTCTTTTGTTCTGACCT
CTTTTCTTTTAGCACGGTAGGTAACCACTGACAATTTTTGAGTAGTATGGTGTGGTGGAGAACGATCGATATATTTTGAAATTAGTACGTACGTTATCAT
GATTATATAAAT
>LE_HBa0117B06_SP6_39610 (trimmed for quality and cloning vector)
GGTGTTTGCTTGGCCTGGAGTGAGAGCTGTATAAGAAAAGCCTATAAAAATCCAAAGTGCCCGTGCCCCGTGTTGCGCAGTTCAGAGTACCTGTTTCTTC
TTTGCAGCACGATTCAAGCTACAAAATCCTTTATTTCCTTATATAATACTGGATGATTGGGAAAGAACAAAATAGGTGGTATTTTGCAGGGGTTGCTTTT
TCAAGACATAGTCTAAGTTAACTTGCTGTTACCTTGTTTTTTTAAAAAAGTTAAAAGTCTGTTACCTTGGTATTCTTGGTGGAAAGTAGAATAAACATGA
ACTTAAG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.946692
Expected error %
0.231435
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0117B06
Clone
Clone name
hba-117b6
LE_HBa0117B06
C06HBa0117B06
P117B06
Clone type
BAC
Contamination
none
Estimated length
124,341
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found