Clone Read LE_HBa0117B06_T7_39611

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0117B06_T7_39611
Primer
T7
ID from Seq. Facility
LE_HBa_117_B06-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
627 trimmed for vector and quality, 898 raw
Genbank Accession
Sequence
>LE_HBa0117B06_T7_39611 (raw untrimmed)
GGGGTTAGCGGGGCCGGTGGGATCTCTAGAGTCGACCTGCAGGCATGCTAGCTTGGGGGTTTATTATGAATACCCTTCTTTTAAAACTGGTATTGTTGCT
CGAATTGGCAATGGTTCTCCCCCTGTTGTTGCTTTGCGAGCCGATATGGATGCCCTTCCTATGCAGGTTTGTCCCAATTACTTATGTGCAAAAAGATTCA
ATTTTTCCTTATTTACATAGCATTCCCTCCGTTTCAGTTTGTTTGTCTGATTTTGTATTGACAAGAAGTTAACAAAACTTTTGAACATATATTGAATTTA
CTAAAATGTCATATAAACTTGTGATGTTAAAGATGCTGTGAAAAGTTAGAACGAAAGACTTGTCAGAAAAGAAACAGATTTGTTTTGAAATGGGCTAAAA
AGGAAAGTAAGATACATAAATTTAAAATTAAGTGAGTATAATTTCTAAATGTCCTTCCACCCCTCTACCTCCGCCCTGAGTTGGGCTGTATCAAATCTAG
AGGATTCAATATTACTTAGATTGTTTTTACACTGGTTGTCAGCATGTCACAATCCTCCAGCTTTATTTGGAGTTATGACAGACTATGCTCTATGAAGATT
ATATAGGGGAGTTATAAAGAGATAATTTGTACTGTGTATATTTATGTGTGAAATTTCTCTGGTATTGATCTCAAATGAATATAACCGTAGGAACTTGTTT
GAATGGGAACATAAGAGCAAAATTAATGGCAAAATGCATGGATGTGGAAATGATGCTCATACAACAATGCTTCTTGGGGCCGCTAAGCTCTGAATGGAAC
GAAAGACAAACTAATGTGAGTTCCTTTGATGTTGGGTTTAATGGAACTTACTCCTCTAGAAATCAGATCATTTAGAAAGTAACTCGAGCTAGAAATAA
>LE_HBa0117B06_T7_39611 (trimmed for quality and cloning vector)
GGTTTATTATGAATACCCTTCTTTTAAAACTGGTATTGTTGCTCGAATTGGCAATGGTTCTCCCCCTGTTGTTGCTTTGCGAGCCGATATGGATGCCCTT
CCTATGCAGGTTTGTCCCAATTACTTATGTGCAAAAAGATTCAATTTTTCCTTATTTACATAGCATTCCCTCCGTTTCAGTTTGTTTGTCTGATTTTGTA
TTGACAAGAAGTTAACAAAACTTTTGAACATATATTGAATTTACTAAAATGTCATATAAACTTGTGATGTTAAAGATGCTGTGAAAAGTTAGAACGAAAG
ACTTGTCAGAAAAGAAACAGATTTGTTTTGAAATGGGCTAAAAAGGAAAGTAAGATACATAAATTTAAAATTAAGTGAGTATAATTTCTAAATGTCCTTC
CACCCCTCTACCTCCGCCCTGAGTTGGGCTGTATCAAATCTAGAGGATTCAATATTACTTAGATTGTTTTTACACTGGTTGTCAGCATGTCACAATCCTC
CAGCTTTATTTGGAGTTATGACAGACTATGCTCTATGAAGATTATATAGGGGAGTTATAAAGAGATAATTTGTACTGTGTATATTTATGTGTGAAATTTC
TCTGGTATTGATCTCAAATGAATATAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.950355
Expected error %
0.307967
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0117B06
Clone
Clone name
hba-117b6
LE_HBa0117B06
C06HBa0117B06
P117B06
Clone type
BAC
Contamination
none
Estimated length
124,341
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found