Clone Read LE_HBa0236O10_T7_396213

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0236O10_T7_396213
Primer
T7
ID from Seq. Facility
LE_HBa_236_O10-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
290 trimmed for vector and quality, 973 raw
Sequence
>LE_HBa0236O10_T7_396213 (raw untrimmed)
CTCCATAGATCACCGCGGGGGTATGCGCTCGTGAATTGAATTCTGAAAGAGACCCTTATCTCGCTTGACGCGATAATGGATACTCAATTCAATGCTTAAT
AA
AACAAAATTAAAGATGCAGTTTATATGAAATGTTTAAATCGTACGAAAAAACTCAATATACGTATATACAATAAAATAATATAACTTTGTGGGAGTTT
CTCTAACCGACAACTATCACTTTGATCTATGTGATGATACAACGTCTCACCCATGCTGCCAGAATTGTACTATAACTTGTCGAGATATAGAACGCGTCAG
CTAAGTGGATCCACTAGTATATGCGAAAAATCATTAAAGAATCCTCTAAAAAGTATTATTCTTTTTACCCATGGTGGCTACATGATTTATGGAGACATTG
GGTTGTTATTAATTCTTCCTCACATCGGTGTTCAATAGTACTCCCCAAAATACTCAACTCATATGTTTTAAAAACCAAAAATTCTTTTTTTGATTTGCCA
TAATTACTCAAAAACTACCTCAAAACCTTTCTTGGAAATCAGTGTTTCTTGTATAGGTTAAATGTGAAAACATATACTCTTTGGGAATACTTATGGTCCG
TTTGGTGTTACGCATAAGCCATAAATAGTCTTTGGCCAAAAATACAAGTCCGGGGTATGAAATTTACATGTCTTGTTAGGGATGACATGTTCGGGATAAC
TTCTCCCCACCCTTTATATCCAAATGATGCCATTCGTTATCCCACAAACAGGGTGCCCTAAGGTAATCCCCAAAAAATAGGTAAAATTTCCTAGAAATTG
TTTCCCAAACAACTAACCTTCTAGCCCCTTTAACGTATCTTATGAATCAAATCAAACTCTCTTTTGTAACCTTTCCCCTTAACCCCCACCATTTAAAGCT
TAGAATTCCTATTACACCATTTTTCAAAAAAATTCTCTTCAAACGATTCAATTAACCCTTCCCCAACTTGGGA
>LE_HBa0236O10_T7_396213 (trimmed for quality and cloning vector)
AACAAAATTAAAGATGCAGTTTATATGAAATGTTTAAATCGTACGAAAAAACTCAATATACGTATATACAATAAAATAATATAACTTTGTGGGAGTTTCT
CTAACCGACAACTATCACTTTGATCTATGTGATGATACAACGTCTCACCCATGCTGCCAGAATTGTACTATAACTTGTCGAGATATAGAACGCGTCAGCT
AAGTGGATCCACTAGTATATGCGAAAAATCATTAAAGAATCCTCTAAAAAGTATTATTCTTTTTACCCATGGTGGCTACATGATTTATGG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.940469
Expected error %
1.86426
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0236O10
Clone
Clone name
hba-236o10
LE_HBa0236O10
P236O10
Clone type
BAC
Contamination
none
Estimated length
112,633
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found