Clone Read LE_HBa0219I17_T7_396252

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0219I17_T7_396252
Primer
T7
ID from Seq. Facility
LE_HBa_219_I17-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
746 trimmed for vector and quality, 998 raw
Sequence
>LE_HBa0219I17_T7_396252 (raw untrimmed)
NNNGGCTATGTCGGGGTCTCTGAGTGACCTGCAGCAGCAAGCTTTTCCACTTGTTTTTTTGGAGACTTAGACCCCCTAGATTTATTGGTGTAGTGACTAC
ATCCCAATTTGCTAAATGAAGCTTTCTTTTTTCCTTTGTCGAACCCCACAAGAAATGTCTTTGGATTTGGTCTATATGTTTTATGACATTTTGAGGAATG
AGGTTGCATTTCATAGCTAGTTAGGAATAGAAGCTAACACAATTTAATTATGGTTTTTGGTTCTCTCTGCAAACTAATAACAGATAGTATTAAATAAATA
GTATTAAATAATATTAGTATTTACTGTGTACTAATCCTAGTCCTATTAGGATTAGTACTCCTTAATCCTAGTCCTATTAGGATTAGTACTCCTTCCTATA
TCTCCTATATATATCTCCCATGTATTCCCTTATTAGGTTAACACTTCAATACAATCAATATTCCTTCATGGTATCAAGAGCCAGAAAACCTAGATCTTCT
TTTCTCTAGGTTTTTCTCTCTCTTTAGGGCACCGATCGTTCCCTCTCTTCTCTTGGGCGGCGGCAGCCGTGACAACCGAGGTGGATTCTCTCGATTCACT
TCCTTCTGGCGTTAAACTCCTTCTCAGGCATCTTCATGCCTGATTCCCGAAAAATTATCAGACATAAATTACCCTACATGGAAAATCACCATTTTTACAG
CCCTTAAGGCCAATTACCTTCTCAAATACGTTGATGGAAGCACAGAACCGCCGCCGGTAGTCATCACCACCATGGACAAATCAGAAAAAACTAATCCGGC
CCATGCCGCCTGGAAAGCCGTGGATGGCCAGATCCGATCATGTTTGATTGCGGTCATCTCTCCCACGGTTCAGAAACACGTCCGATGCTACACAACTGCT
TCAGCCCTGTGGACGGCCCTCCCACCACCCATGCACCAATTTCCCCTCCCCAATTTTTCAATGGGAGGATCGCCCCCCCCCAATTCCAAAGGGGCGAA
>LE_HBa0219I17_T7_396252 (trimmed for quality and cloning vector)
GCAAGCTTTTCCACTTGTTTTTTTGGAGACTTAGACCCCCTAGATTTATTGGTGTAGTGACTACATCCCAATTTGCTAAATGAAGCTTTCTTTTTTCCTT
TGTCGAACCCCACAAGAAATGTCTTTGGATTTGGTCTATATGTTTTATGACATTTTGAGGAATGAGGTTGCATTTCATAGCTAGTTAGGAATAGAAGCTA
ACACAATTTAATTATGGTTTTTGGTTCTCTCTGCAAACTAATAACAGATAGTATTAAATAAATAGTATTAAATAATATTAGTATTTACTGTGTACTAATC
CTAGTCCTATTAGGATTAGTACTCCTTAATCCTAGTCCTATTAGGATTAGTACTCCTTCCTATATCTCCTATATATATCTCCCATGTATTCCCTTATTAG
GTTAACACTTCAATACAATCAATATTCCTTCATGGTATCAAGAGCCAGAAAACCTAGATCTTCTTTTCTCTAGGTTTTTCTCTCTCTTTAGGGCACCGAT
CGTTCCCTCTCTTCTCTTGGGCGGCGGCAGCCGTGACAACCGAGGTGGATTCTCTCGATTCACTTCCTTCTGGCGTTAAACTCCTTCTCAGGCATCTTCA
TGCCTGATTCCCGAAAAATTATCAGACATAAATTACCCTACATGGAAAATCACCATTTTTACAGCCCTTAAGGCCAATTACCTTCTCAAATACGTTGATG
GAAGCACAGAACCGCCGCCGGTAGTCATCACCACCATGGACAAATC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.964503
Expected error %
0.164471
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0219I17
Clone
Clone name
hba-219i17
LE_HBa0219I17
P219I17
Clone type
BAC
Contamination
none
Estimated length
84,827
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found