Clone Read LE_HBa0219L06_T7_396489

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0219L06_T7_396489
Primer
T7
ID from Seq. Facility
LE_HBa_219_L06-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
199 trimmed for vector and quality, 991 raw
Sequence
>LE_HBa0219L06_T7_396489 (raw untrimmed)
NCCCTAGGACGGGTATCCTAGATTGGGCTCTCGAGGGATAGCCTAGATCGGACGCCCAAACTAATACTTCAAAATACTTCGACTTGGGGGCGGCTATATT
CCCCTCGATTTGGACAAATATCATTCTGATAACCATAAGAGATCCTTAGGCAGGTTAGAAATTTGCAGGTATTATTATTTCACCTTCTAGCAGCATA
AAA
TAAATACACGAATTCCCTTTTAAGTTTATACGTTTATTAGTTCATATCTCTAAATTGCAAGACCTAACATGTTATTAGATTTTATACATGGATAACTAAC
GTTCCTGACGAGCTACCAAGCATGGTACATATAAACAACTAAGCTACAGAGTATAATTAATTATCTTGTAACATCTAACTTAGCCATAGTTAGTTATAGC
AGTGTAGTAGTTTGTTATTCTTGCAGTTAGTTAGGTAGGTAGAATCATCTCAATCACGTGTATATAATCCTACACACATAAATGAAATGTAAGATAATAC
AACTCCCATAACTGTTTTCTTTCCAATGCCGGTAATGGCTTCGCTGCTTCAGCTCAGTTGAGTATTCACCATTGTTGTGAGTTTTGATAGTACAACTTAG
GCAGAAATTAATTCATGAATAAACTTAACCCTTTTCCTTACCAGCTTAGGATGTGCGGAAAAAAATGTACCTGGAATAACCACCTCATACCATCTCTAGT
ATCCCCGGGACAAGGCTGCAATAAGCTAAGTAGCCACTAGCAACAAATCTATGCACATGCTCTTGCAATTCTCACACAGGAAATGCTTAATTGCGTCGAC
ATGCTTTTAGTGCATTCAACGCCTCATTCTCCAAATCATTTCGTTCCAGTTCTTCCCTATGCTTGATCCCACAAATACTTCACCAATAAGAAGTCACTCC
TGCATGCCACTCCCAGTTTTCGGGGCCCGAAAACGGAATTCCCTCCAAGATGCTCTGACCCTAATGAATTGGTGGCCGAAAAAAAAAAATC
>LE_HBa0219L06_T7_396489 (trimmed for quality and cloning vector)
AAATAAATACACGAATTCCCTTTTAAGTTTATACGTTTATTAGTTCATATCTCTAAATTGCAAGACCTAACATGTTATTAGATTTTATACATGGATAACT
AACGTTCCTGACGAGCTACCAAGCATGGTACATATAAACAACTAAGCTACAGAGTATAATTAATTATCTTGTAACATCTAACTTAGCCATAGTTAGTTA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.919541
Expected error %
2.3734
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0219L06
Clone
Clone name
hba-219l6
LE_HBa0219L06
P219L06
Clone type
BAC
Contamination
none
Estimated length
64,059
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found