Clone Read LE_HBa0237F15_T7_396945

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0237F15_T7_396945
Primer
T7
ID from Seq. Facility
LE_HBa_237_F15-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
461 trimmed for vector and quality, 726 raw
Sequence
>LE_HBa0237F15_T7_396945 (raw untrimmed)
GAAAAGGATCCTTGTTGTTACTTCAAAATACACTGATTAACAATCTGAAGTGGATGATATATTGATTGCAGGATCTAGTATGGGGGATATTAACAATCGG
AAGACAAGGTTGTCTGCAGCGTTTGAGATGAAAGATTTGGGTCCAACGAAGCAGATTTTGGGGATGAAGAATTCTCGGGATAGATCTGCTGGCACTTTAA
ATCTTTCTCAGGAATTGTACATTGAGAAGGTGCTGAGCAGATTCAGGGTTAATGATGCTAAACCCAGGACTACTCCATTGGCAAATCACTTTAAATTGTC
AAAGGAGCAGTCGCCCAAGACTGCTGAGGAGCGTGATCACATGGCACTTGTTCCATATGCTTCAGCAATTGGTAGTTTGATGTATGCTATAATTTGCACT
AAATCTGATATATCACATGCAGTGGGAGTTGTAAGCAGGTATATGGTGAACCCTGGGAAAGAGCATTGGGAAATTGTGAAGTGGCTTTTGAGATATCTGA
GAGGTAAATCCAGTATTTCACTTAGTTTTGGCAAAGGCAATGTTGACTCTACAGGGTTTTGTGGATGCTGATCTTATTGGGGATTTTGACCCAAGAAAGA
TTTCTTCGGGGTACATTTTCCCCTTAAGAGGGAACAACACTGAGTTGGATTTCCAGGCTTCATAAGTTGGTTTCTCTTTCTTCTATTGAAATCTTAGATT
GTGGCATTATCTTTAATTGGGTTAAA
>LE_HBa0237F15_T7_396945 (trimmed for quality and cloning vector)
GAAAAGGATCCTTGTTGTTACTTCAAAATACACTGATTAACAATCTGAAGTGGATGATATATTGATTGCAGGATCTAGTATGGGGGATATTAACAATCGG
AAGACAAGGTTGTCTGCAGCGTTTGAGATGAAAGATTTGGGTCCAACGAAGCAGATTTTGGGGATGAAGAATTCTCGGGATAGATCTGCTGGCACTTTAA
ATCTTTCTCAGGAATTGTACATTGAGAAGGTGCTGAGCAGATTCAGGGTTAATGATGCTAAACCCAGGACTACTCCATTGGCAAATCACTTTAAATTGTC
AAAGGAGCAGTCGCCCAAGACTGCTGAGGAGCGTGATCACATGGCACTTGTTCCATATGCTTCAGCAATTGGTAGTTTGATGTATGCTATAATTTGCACT
AAATCTGATATATCACATGCAGTGGGAGTTGTAAGCAGGTATATGGTGAACCCTGGGAAAG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.95074
Expected error %
0.0702728
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0237F15
Clone
Clone name
hba-237f15
LE_HBa0237F15
P237F15
Clone type
BAC
Contamination
none
Estimated length
67,827
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found