Clone Read LE_HBa0221F06_SP6_397391

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0221F06_SP6_397391
Primer
SP6
ID from Seq. Facility
LE_HBa_221_F06-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
628 trimmed for vector and quality, 963 raw
Sequence
>LE_HBa0221F06_SP6_397391 (raw untrimmed)
TAGTGTGAGTTTTGGCTAGATGCAGTGTCCTTTTTGGGGCACGTGGTTTCTACCTGTTGGAGTGATGGTGGATCCTTCTAAGATTGAGACAGTGAACAAT
TGGGTAAGACCTACTAATGTGTCAGAAATAAGGAGCTTTGTTGGGTTAGCTAGCTACTACCGCCGATTTGTCAAGGGATTCTCTTCTATTTCTTCCCAAC
TGACGAACTTGACTAAAAAAAATGTTCCATTTGTATGGTCGGATGAGTGTGAGGAAAGCTTTCAGAAGCTCAAGACTTTGTTGACTACCGCACCCATTCT
CACCTTTCCAGTGGAAGGTAAGAATTTCATTGTCTATTGTGATGCATCATATTCGGGTTTGGGTGCAGTGCTAATGCAAGAGAAGAGTGTGATTGCTTAT
GCTTCAAGGCAACTAAAGGTGCATGAACGTAACTATCCGACCCACGATTGGAATTGGCTGCGGTAGTGTTTGCATTAAAGCAATGGAGACCCTATTTATA
TGGGGTTAAGTGTGAGATCTATACGGATCATCGTAGCCTACAGTATGTCTTTACTCAGAATGATTTGAACTTGAGACAGAGGAGATGGATGGAACTACTA
AAGGACTACGACATCACTATTTTGTATCATCCGGGGAAGGCGAATGTTGTAGCGGATGCTTTAAGTACCAAAGGTGGGAAGCATGCGCAGTCTAGCTCAC
TTGCAAGCTTCTAAACGCCCATTGGGCTAGAGAGGTTTCAAACTCTAGCTTACCGACTTAATGAGATTACAATTTAATTGAAAAGGGGGGGATTGTTGGC
CCTGGGGGCAACCAAGATTCTTCTTTTTCTTTTCCCCATTAAAGGGAAAACTAGTTTTGAAGAGGTGAAAACCTAGGGCAAATCCCAATAAAAAATTTTT
GGAAAGGGGAGGCTTTAAGGAAACTCTTAATCTTTTGAAAAAGGTTGTTTTTAAAAACCTAGG
>LE_HBa0221F06_SP6_397391 (trimmed for quality and cloning vector)
TGTGAGTTTTGGCTAGATGCAGTGTCCTTTTTGGGGCACGTGGTTTCTACCTGTTGGAGTGATGGTGGATCCTTCTAAGATTGAGACAGTGAACAATTGG
GTAAGACCTACTAATGTGTCAGAAATAAGGAGCTTTGTTGGGTTAGCTAGCTACTACCGCCGATTTGTCAAGGGATTCTCTTCTATTTCTTCCCAACTGA
CGAACTTGACTAAAAAAAATGTTCCATTTGTATGGTCGGATGAGTGTGAGGAAAGCTTTCAGAAGCTCAAGACTTTGTTGACTACCGCACCCATTCTCAC
CTTTCCAGTGGAAGGTAAGAATTTCATTGTCTATTGTGATGCATCATATTCGGGTTTGGGTGCAGTGCTAATGCAAGAGAAGAGTGTGATTGCTTATGCT
TCAAGGCAACTAAAGGTGCATGAACGTAACTATCCGACCCACGATTGGAATTGGCTGCGGTAGTGTTTGCATTAAAGCAATGGAGACCCTATTTATATGG
GGTTAAGTGTGAGATCTATACGGATCATCGTAGCCTACAGTATGTCTTTACTCAGAATGATTTGAACTTGAGACAGAGGAGATGGATGGAACTACTAAAG
GACTACGACATCACTATTTTGTATCATC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.976009
Expected error %
0.539084
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0221F06
Clone
Clone name
hba-221f6
LE_HBa0221F06
P221F06
Clone type
BAC
Contamination
none
Estimated length
29,514
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found