Clone Read LE_HBa0221I19_T7_397716

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0221I19_T7_397716
Primer
T7
ID from Seq. Facility
LE_HBa_221_I19-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
773 trimmed for vector and quality, 966 raw
Sequence
>LE_HBa0221I19_T7_397716 (raw untrimmed)
GATGTCGGGGACTCTGAGTCGACTGCAGGCATGCAAGCTTGTTTCGCAAAGGAATCATATTCCCATAGCAACTCTGGAAAATAAATGATGATAGATGGTG
CAAGGCCAAAGTGAACGAAGCAGATCCTCGACGTGCTGCTTTGTCTAGAGCTCCTGAAACCCATGATTTACAGTAAGCTTCCAACATCCTCTCATCATCC
TGCATCAAAATATTAATCACCACAAGTAAGCAAAGTATAATTATGTCTTTGTTTACAGAAAAATTAAAAGAGCTTTCCTCAAATCGACTTGGCTAAAAAT
CGGACAACACAAGCAATCATTCTCTCGATTCACTCTTTCCCAAACAATGTTTTGCAATGCCACAGTTATCATCATATTGCCAATATCCTTTCCTTTTACC
TTGTAACTTTTTGTTGTCATACTACCTTGCTCTTAGGCGGCAGTGTCTTGTACAAGGCAGGATACGAACAAGATTAATTATCATTATTTATATATGACAT
CCTGAACAACTAATACAACAACAAGAAGAAGACGCCCAGGGTCTATTAAGGTTAAGATGTACACAAACCTTACCCCTACCCTTGTCGGATAGAGAGGTTG
TTTTGGATAGACCCTCAGCTCAAAAGAAACCAATAAATCTTGTGTTACCATCCACAACAACGACATACCCAATGTACCTCCAGAACATACACGTTATTTT
AAAACTGTAACATGGACAGATGCAGCCCCTCCCGTCAAACAGCAATTTTCATTTCCCTTTCCTTTTTCCCGTGTCTTTCTTTCCCATTTTCTTTTTGATT
ATAATATGAAGAGCAAGAGGGAAGCAAAGCACAGAGAAGTCTCGGCTATTCTTTTTCCTCCCAATTTCCATCAAAACATGAAGTGGACAAAAACATGGAA
TATATGTCATTTTTAGCAAGTCATTTAGCTGCACCGCCCTTGTAGCACACTCGTAGACAATGACAN
>LE_HBa0221I19_T7_397716 (trimmed for quality and cloning vector)
GCAGGCATGCAAGCTTGTTTCGCAAAGGAATCATATTCCCATAGCAACTCTGGAAAATAAATGATGATAGATGGTGCAAGGCCAAAGTGAACGAAGCAGA
TCCTCGACGTGCTGCTTTGTCTAGAGCTCCTGAAACCCATGATTTACAGTAAGCTTCCAACATCCTCTCATCATCCTGCATCAAAATATTAATCACCACA
AGTAAGCAAAGTATAATTATGTCTTTGTTTACAGAAAAATTAAAAGAGCTTTCCTCAAATCGACTTGGCTAAAAATCGGACAACACAAGCAATCATTCTC
TCGATTCACTCTTTCCCAAACAATGTTTTGCAATGCCACAGTTATCATCATATTGCCAATATCCTTTCCTTTTACCTTGTAACTTTTTGTTGTCATACTA
CCTTGCTCTTAGGCGGCAGTGTCTTGTACAAGGCAGGATACGAACAAGATTAATTATCATTATTTATATATGACATCCTGAACAACTAATACAACAACAA
GAAGAAGACGCCCAGGGTCTATTAAGGTTAAGATGTACACAAACCTTACCCCTACCCTTGTCGGATAGAGAGGTTGTTTTGGATAGACCCTCAGCTCAAA
AGAAACCAATAAATCTTGTGTTACCATCCACAACAACGACATACCCAATGTACCTCCAGAACATACACGTTATTTTAAAACTGTAACATGGACAGATGCA
GCCCCTCCCGTCAAACAGCAATTTTCATTTCCCTTTCCTTTTTCCCGTGTCTTTCTTTCCCATTTTCTTTTTG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.966299
Expected error %
0.255039
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0221I19
Clone
Clone name
hba-221i19
LE_HBa0221I19
P221I19
Clone type
BAC
Contamination
none
Estimated length
95,906
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found