Clone Read LE_HBa0238G19_T7_398669

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0238G19_T7_398669
Primer
T7
ID from Seq. Facility
LE_HBa_238_G19-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
671 trimmed for vector and quality, 882 raw
Sequence
>LE_HBa0238G19_T7_398669 (raw untrimmed)
NCTTTNCNNNNNNNGGTCTTCAGCGCTCNACGGCCGCCGTGTGATGGATATCTGCAGAATTCGCCCTTAACGCTAGCTACTTGCTAACACATGCAAGTCG
AGGGGCAGCATCATCAAAGCTTGCTTTGATGGATGGCGACCGGCGCACGGGTGAGTAACACGTATCCAACCTGCCGACAACACTGGGATAGCCTTTCGAA
AGAAAGATTAATACCGGATGGCATAGTTTTCCCGCATGGGATAATTATTAAAGAATTTCGGTTGTCGATGGGGATGCGTTCCATTAGGCAGTTGGCGGGG
TAACGGCCCACCAAACCTACGATGGATAGGGGTTCTGACAGGAAGGTCCCCCACATTGGAACTGAGACACGGTCCAAACTCCTACGGGAGGCACCAGTGA
GGAATATTGGTCAATGGACGAGAGTCTGAACCAGCCAAGTAGCGTGAAGGATGACTGCCCTATGGGTTGTAAACTTCTTTTATACGGGAATAAAGTGAGC
CACGTGTGGCTTTTTGTATGTACCGTATGAATAAGGATCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGATCCGAGCGTTATCCGGATTTATT
GGGTTTAAAGGGAGCGTAGGCGGGTTGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGCGATCTTGAGTACAACAGA
GGTAGGCGGAATTCGTGGTGTAGCGGTGAAATGCTTANATATCACGAAGAACTCCGATTGAAGGGCGAATTCCAGCACACTGGCGGCCGTTACTAGTGGA
TCCGAGCTCGGTACCAAGCTTGGCGTAATCATGGTCATACCTGTTTCCTGTGTGAAATTGTTATCCGCTCACCATTCACACA
>LE_HBa0238G19_T7_398669 (trimmed for quality and cloning vector)
ATGGATATCTGCAGAATTCGCCCTTAACGCTAGCTACTTGCTAACACATGCAAGTCGAGGGGCAGCATCATCAAAGCTTGCTTTGATGGATGGCGACCGG
CGCACGGGTGAGTAACACGTATCCAACCTGCCGACAACACTGGGATAGCCTTTCGAAAGAAAGATTAATACCGGATGGCATAGTTTTCCCGCATGGGATA
ATTATTAAAGAATTTCGGTTGTCGATGGGGATGCGTTCCATTAGGCAGTTGGCGGGGTAACGGCCCACCAAACCTACGATGGATAGGGGTTCTGACAGGA
AGGTCCCCCACATTGGAACTGAGACACGGTCCAAACTCCTACGGGAGGCACCAGTGAGGAATATTGGTCAATGGACGAGAGTCTGAACCAGCCAAGTAGC
GTGAAGGATGACTGCCCTATGGGTTGTAAACTTCTTTTATACGGGAATAAAGTGAGCCACGTGTGGCTTTTTGTATGTACCGTATGAATAAGGATCGGCT
AACTCCGTGCCAGCAGCCGCGGTAATACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGGTTGTTAAGTCAGTTGTGAA
AGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGCGATCTTGAGTACAACAGAGGTAGGCGGAATTC

This is probably not a useful sequence.

Problems:
  • Probable foreign DNA contamination
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.98905
Expected error %
0.517763
Sequence Annotations 
Automatic Annotations
Nicotiana tabacum Chloroplast (screening/organelle/nicotiana_tabacum_chloroplast)NCBI BLAST
gi|11465934|ref|NC_001879.1| Score 94 E Value 7e-21 Identity 90.00% Align. Length 252bp (37.56%) Frame 3
Nicotiana tabacum plastid, complete genome
Arabidopsis thaliana Mitochondria (screening/organelle/ATH1_mitochondria)NCBI BLAST
mitochondria Score 62 E Value 5e-11 Identity 97.10% Align. Length 34bp (5.07%) Frame 2
No sequence description found.
E. coli K12 Genome (E.coli_K12/Ecoli_genome)NCBI BLAST
gi|16127994|ref|NC_000913.1| Score 92 E Value 8e-19 Identity 88.50% Align. Length 293bp (43.67%) Frame 3
Escherichia coli K12, complete genome
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0238G19
Clone
Clone name
hba-238g19
LE_HBa0238G19
P238G19
Clone type
BAC
Contamination
none
Estimated length
100,306
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found