Clone Read LE_HBa0222D12_T7_398708

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0222D12_T7_398708
Primer
T7
ID from Seq. Facility
LE_HBa_222_D12-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
645 trimmed for vector and quality, 935 raw
Sequence
>LE_HBa0222D12_T7_398708 (raw untrimmed)
GCAGGCTGCAAGCTTGTGTAAGTCAATTGGAAGCTCTTTGTTTCCGAAAGGGAAACTTCACTCTGTTCTAAATAATCTAAGTTTTCACATTTATGTTTCT
AGTAAACTTTCCATATATGTAAATTATGTGTGTTTGGTAAATTACTTGTAATAGGTTAATTACTTAAATTTATGTAAATTTATTAATATTTTCATGAATC
TATATTACCTAGTATATGGTTAGTCTCTTAGATTCTTAAAAGTATCGACGGATTAACCTTTAAATTCCTAGGAAATTTCTAGGTTTAATGTTCTGAGAAA
AGAACTATGAATAACCAAATTCGGGGTGTGGTTAAAGAAGATTACTTTTAAGAACAAAGGCTAAGAGAAAGAGATGAACAGTAATAATAGATTCATGAAT
GGACAAAGTCCATAAAAAAGAAGAAGTTAAAACTAGAAACTAATATGATAATTACATAATAGAACAAGAGAGTGAAGGAGTACTGAGATCTATTAGTCTT
TCAAATGCTAGTCAACCTCAATCTCTTAGATATCCATTATCCAAACTTGGTTTGTGATCTTTCTACAATTCAAAAGGTGTCTATTTAAATTTTTTATGAG
GCACACAATTCAATACGTAACAAGCCGTCGAAATAGTTTCACCTCATAAATTTAAATGTTCATGTGACTCAATAAGCATAACATTAGTCAATTCAATCAA
AATTTATTTTTTCCTTTCTTCTACTCTATTAGGTAAAGGAAAAATAAGGAAAGATAGGTTTCATAAAATAATTCTCAATGATCTAGCCAAAGGAATAAAT
CTTAATTTGAATCATAATTCATGATCCCCTACCCCTTAAATTTTTTTATTTTTCTTCCAAACGGATTTTCAAATTCATGGAAAAAAATTTTTAAAAAAAA
TTTCAAAAACCATCCCTTTTTATTTTATTCAAAAA
>LE_HBa0222D12_T7_398708 (trimmed for quality and cloning vector)
GCAAGCTTGTGTAAGTCAATTGGAAGCTCTTTGTTTCCGAAAGGGAAACTTCACTCTGTTCTAAATAATCTAAGTTTTCACATTTATGTTTCTAGTAAAC
TTTCCATATATGTAAATTATGTGTGTTTGGTAAATTACTTGTAATAGGTTAATTACTTAAATTTATGTAAATTTATTAATATTTTCATGAATCTATATTA
CCTAGTATATGGTTAGTCTCTTAGATTCTTAAAAGTATCGACGGATTAACCTTTAAATTCCTAGGAAATTTCTAGGTTTAATGTTCTGAGAAAAGAACTA
TGAATAACCAAATTCGGGGTGTGGTTAAAGAAGATTACTTTTAAGAACAAAGGCTAAGAGAAAGAGATGAACAGTAATAATAGATTCATGAATGGACAAA
GTCCATAAAAAAGAAGAAGTTAAAACTAGAAACTAATATGATAATTACATAATAGAACAAGAGAGTGAAGGAGTACTGAGATCTATTAGTCTTTCAAATG
CTAGTCAACCTCAATCTCTTAGATATCCATTATCCAAACTTGGTTTGTGATCTTTCTACAATTCAAAAGGTGTCTATTTAAATTTTTTATGAGGCACACA
ATTCAATACGTAACAAGCCGTCGAAATAGTTTCACCTCATAAATT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.926291
Expected error %
0.310456
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0222D12
Clone
Clone name
hba-222d12
LE_HBa0222D12
P222D12
Clone type
BAC
Contamination
none
Estimated length
99,826
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found