Clone Read LE_HBa0238L19_SP6_399156

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0238L19_SP6_399156
Primer
SP6
ID from Seq. Facility
LE_HBa_238_L19-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
622 trimmed for vector and quality, 853 raw
Sequence
>LE_HBa0238L19_SP6_399156 (raw untrimmed)
NNCCGTACCTGAAGAGCTTTAGATAGTCATCCTAATTGTTGTTCTGTGGGGTAAAAATCATCCCATTTAAGGTGGTCTTTATATAATATGAAATGCCCTT
GAATCTATTATAATTGATTTTGTAAAGCTTGGATTTAAAATTCCATTAAAGTAAGTAATGCAACTTCTGGTCCTTCTAGGAGCTTTGGCATTTGATGTAG
AATATGCCCGATGGTTGGAAGAGCAGAACCGACGAATTAATGAATTAAGGGGAGCTGTTAATTCTCATGCTGGTGATGCTGAACTTCGCATAATAGTCGA
TGGAATACTGGCACACTATGATGACATATTCAGGATAAAGGGGGATGCGGCGAAGGCTGATGTTTTTCACATATTGTCGGGCATGTGGAAAACTCCTGCA
GAAAGATGCTTCTTGTGGCTTGGTGGATTCCGTTCATCTGAACTACTCAAGGTGAGAGATTTGTCTTCCCACAAGTGAATGTGCATCTTGGTGAATAGCT
TTCTCCACCCTCCTTTTGGCTAAAAAATGACCAAGATAATATAAAAAAATAAAAGCTCATATCCTTGTGAATGGAGGTTCTTTTTTCATTTTACCATAGG
AAGGAACTGTAGAGAAAAAAAAATCAATTTCTGACCCAAGTTCTTCTTTTTTTTTTTTTAAAAAAGGAAAAGGGTCAAAAATACCCTTGAACTATCAGAA
ATAGCTCAAATATACCCCTTTGAATATATTTCGGCTCAAATATACCCCTTACCGTCAAACTATTGGGTCAAAAATACCCTTCTTCATAAACAAAATCGGT
TTAAAAGTCCCTTTAAAGCCCTGGGGGATGTCACATGGCATTGCACATTGGCC
>LE_HBa0238L19_SP6_399156 (trimmed for quality and cloning vector)
ATTGTTGTTCTGTGGGGTAAAAATCATCCCATTTAAGGTGGTCTTTATATAATATGAAATGCCCTTGAATCTATTATAATTGATTTTGTAAAGCTTGGAT
TTAAAATTCCATTAAAGTAAGTAATGCAACTTCTGGTCCTTCTAGGAGCTTTGGCATTTGATGTAGAATATGCCCGATGGTTGGAAGAGCAGAACCGACG
AATTAATGAATTAAGGGGAGCTGTTAATTCTCATGCTGGTGATGCTGAACTTCGCATAATAGTCGATGGAATACTGGCACACTATGATGACATATTCAGG
ATAAAGGGGGATGCGGCGAAGGCTGATGTTTTTCACATATTGTCGGGCATGTGGAAAACTCCTGCAGAAAGATGCTTCTTGTGGCTTGGTGGATTCCGTT
CATCTGAACTACTCAAGGTGAGAGATTTGTCTTCCCACAAGTGAATGTGCATCTTGGTGAATAGCTTTCTCCACCCTCCTTTTGGCTAAAAAATGACCAA
GATAATATAAAAAAATAAAAGCTCATATCCTTGTGAATGGAGGTTCTTTTTTCATTTTACCATAGGAAGGAACTGTAGAGAAAAAAAAATCAATTTCTGA
CCCAAGTTCTTCTTTTTTTTTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.952755
Expected error %
0.604905
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0238L19
Clone
Clone name
hba-238l19
LE_HBa0238L19
P238L19
Clone type
BAC
Contamination
none
Estimated length
103,970
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found