Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Clone Read LE_HBa0222J15_SP6_399286

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0222J15_SP6_399286
Primer
SP6
ID from Seq. Facility
LE_HBa_222_J15-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
538 trimmed for vector and quality, 988 raw
Sequence
>LE_HBa0222J15_SP6_399286 (raw untrimmed)
AGGTTGACTTCCACATGTTCGTTCGTAGCTGCACTACGCTGCCACCTACGGACCGTCACAAGCACGACGGACCATCATAAGCTCCGTAGGTGGCCTCTTC
TGCATTTCTTCGCTCAAAATCTACGCATTTAGTTTTGGACAGATTTCCTGCAAAACAAAGAGAAACTTTTATAAAAATTAGCACAAAAAGGCTTTTGGAC
ACACTAAACTTAAGGAAAAAGTATTAATAATATCGTGAAACCACGGTATATCAACACCCTCAACTTAAATTCGTTGTTTAGTCTGCAAGCGATGCTGTCA
CGACCCAAAAATGGACGTGATGACACTCGTCTTATACCACCAAGACAAGTAAGCCTAAAACTCAACTATTACAATAAAAATGCGGAAAATTTACTATCAA
CTTACATTATACCCCATAACCTGGTTGTCACGTGTACAGGCGTCTAAAGTATTACAATCGGATCAAAAGAAAATATAAGTCTCATATGATATTGTTTCTA
GAGTAGAAAAAAATCATAAACAAGAGTAAGGAGGGATGCTGAGATGACCAACAACTACCTCACAAAATCTCCAGGAAGCCTCGGAAAAGAAGAGACTATA
TCATAAAGTCCGGGCTAGTAACCTACAAAAATTCGTAGAACCAAGGGGTGAGTACCAAACCACACGGTACTCAGCAAATAAACCTTCTAACACAAGCTTA
GGGGATGAAAATCCGGTTACTCCTAACACCCCCCAACGAAACCTCCTCAATTACAACCTACATAAACCTAAACCCCAACTTAAAAAATCCCTAGTTTTAC
GTATTACCGGACCCCCATAATAAACCTTTAAAACAAATTAAAATATCCTCGCCCAACAACCCTTTAAACAAAATTACTGATCCCTCCCAAAACAACACTT
TAAAAATTTATTTTCCCCCCGCCCTTCCGGAATTTAACTAAATTTGATTTTCCCTTCATTGCTAACTCTTCCCAAAAGATTTACATTG
>LE_HBa0222J15_SP6_399286 (trimmed for quality and cloning vector)
CACCTACGGACCGTCACAAGCACGACGGACCATCATAAGCTCCGTAGGTGGCCTCTTCTGCATTTCTTCGCTCAAAATCTACGCATTTAGTTTTGGACAG
ATTTCCTGCAAAACAAAGAGAAACTTTTATAAAAATTAGCACAAAAAGGCTTTTGGACACACTAAACTTAAGGAAAAAGTATTAATAATATCGTGAAACC
ACGGTATATCAACACCCTCAACTTAAATTCGTTGTTTAGTCTGCAAGCGATGCTGTCACGACCCAAAAATGGACGTGATGACACTCGTCTTATACCACCA
AGACAAGTAAGCCTAAAACTCAACTATTACAATAAAAATGCGGAAAATTTACTATCAACTTACATTATACCCCATAACCTGGTTGTCACGTGTACAGGCG
TCTAAAGTATTACAATCGGATCAAAAGAAAATATAAGTCTCATATGATATTGTTTCTAGAGTAGAAAAAAATCATAAACAAGAGTAAGGAGGGATGCTGA
GATGACCAACAACTACCTCACAAAATCTCCAGGAAGCC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.96356
Expected error %
0.80861
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0222J15
Clone
Clone name
hba-222j15
LE_HBa0222J15
P222J15
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found