Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Clone Read LE_HBa0222J15_T7_399288

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0222J15_T7_399288
Primer
T7
ID from Seq. Facility
LE_HBa_222_J15-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
535 trimmed for vector and quality, 982 raw
Sequence
>LE_HBa0222J15_T7_399288 (raw untrimmed)
TATCTATAGTGACTGCAGGCTGCAAGCTTCTTCAAACAAGCCCAATTCGAATGTGGTTCATTCTCATCTATGCCTTCCTTCCACTGGTCGTACGAAGTCC
TAGACACACTCTTCAGTTAGTGGGCAACCATTTCAACTCTCTCAATACAAACAACATGCATTACATCGAACACCTTCTTCAACTCTTCCACAAAGTTGTT
CGAATCATGAGTAGCGTTTGAACAAGTGAAGCTTGGGGGATTCATTCTCAAGAATTCTTGAATCCTCAAAATGTCTGCCCCTTCTTGTCGAGCTTCTGTT
TGTTGCCCAAATCGGTTGGTCGCAAATTGACTCAAGAAGTTTGTCAAACCCCGAGCCTACACCTTGGATGTGGGCGACACTCAGTGGCCATTGCTAGATT
CGAGGGAACCTTTTACTGGCTTACATAACTTGGCGTAAGACAACAATAAGACTTGTAGGGATAAAAGAACTTAAGTGAACTAAATAGTAATACTATTTGA
AATTTTTGAAAATTCTAAACATTCAAATTGTTCTAAATGGAAAACCAAGTCATTAACATATAAAAAGAAAATGTAAAGACTACTGAACTACTTACTGTCT
ATGAAATCTCTAGACATACGAAAATGAATGTGGGGACAAACCACACAACATTCTATTCAACTAATCTAGAAAATCAATAAAATGTGACCTCTATAATGGC
TCACCTCCTGACTTCGGGAGTGCTTATTCGGATGAAAACTTACCCTAAATGTCGAAGCTCAATTACAGGCATCTACCTTAAGAATATTATGTAAATCCAA
CTTGGATTTCTTAACAATGAATAAAATTGTTCTGAAAATTTTAAATGCTAAACTTTTTATTTGCAAATTCCCTGTTTTAAAAGAGTATTCCTATTCAATA
ATAATTGTTTTCATGAAAAAACCTTTAATAAGACTCTGAAACCTATATAAAGTTATTGAAATAAACTAATTGTAATGATCTG
>LE_HBa0222J15_T7_399288 (trimmed for quality and cloning vector)
AGCTTCTTCAAACAAGCCCAATTCGAATGTGGTTCATTCTCATCTATGCCTTCCTTCCACTGGTCGTACGAAGTCCTAGACACACTCTTCAGTTAGTGGG
CAACCATTTCAACTCTCTCAATACAAACAACATGCATTACATCGAACACCTTCTTCAACTCTTCCACAAAGTTGTTCGAATCATGAGTAGCGTTTGAACA
AGTGAAGCTTGGGGGATTCATTCTCAAGAATTCTTGAATCCTCAAAATGTCTGCCCCTTCTTGTCGAGCTTCTGTTTGTTGCCCAAATCGGTTGGTCGCA
AATTGACTCAAGAAGTTTGTCAAACCCCGAGCCTACACCTTGGATGTGGGCGACACTCAGTGGCCATTGCTAGATTCGAGGGAACCTTTTACTGGCTTAC
ATAACTTGGCGTAAGACAACAATAAGACTTGTAGGGATAAAAGAACTTAAGTGAACTAAATAGTAATACTATTTGAAATTTTTGAAAATTCTAAACATTC
AAATTGTTCTAAATGGAAAACCAAGTCATTAACAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.957352
Expected error %
0.336324
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0222J15
Clone
Clone name
hba-222j15
LE_HBa0222J15
P222J15
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found