Clone Read LE_HBa0239A04_T7_399562

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0239A04_T7_399562
Primer
T7
ID from Seq. Facility
LE_HBa_239_A04-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
717 trimmed for vector and quality, 867 raw
Sequence
>LE_HBa0239A04_T7_399562 (raw untrimmed)
NTTTCCGACGCGGGTTCTCTGAGTCGACCTGCAGGCATGCAAGCTTTAAGGGCAATAAGGTGTAAGTGGTGTAAATTTCATTTAATTTTTCTTTTGAAGA
TGAGAAGAATGGTAAATTTTTAGGCCAAAGAGCAAGTCTGAAGTTACAAGAACTCAAGACTTTGTTCCTTCAAACTTGAGTGCCATCGCTGGGGTAAGTT
GAAGAGATTTTTAAAAGATAGACGAAATAAAGACAGAGTGATAGTTCAACAATTTTTGGTTTTCCCTCTTCATATTCGACACGAATTTTTAAAAAAAAAT
TATGATGTTCTCCACCTATTTTCTACCCCTAAGACACTTGAGTTTAATATAACTACCAAAGGAATGGTTGGAGTGGCTACTAGTCGGAAATCTATCAAAA
TAAGTATACTTCCTAAGATGATCATTTTACACCTGTAGAGGTTTTTCTATTGATGTTATGGAAGTACCAAATTGCATAAACATGTGCATTTTTCTAGTTC
AGGGCGTATCACTAGTTCAAGAGGAAAACGGATATGTTTATGTAATTTTGTACTTCCATAGCTTCCATAACCAAACCGCTTCAGGTGTAAGATCTTCAAC
ATAAAATGGAAAACTAGAAATAGTTGAATTATTGGGACAACAAATTTCCATTCTTCATCGTCTTCCGATGAAACAACAGACGAAGTTTTCCCACTTTAAC
ATGATTTCCCTTCAAGTTTTAGTATGCTTAATATTTTTTATAGAAGTTCACATGTTGTATGAATCATATTTTAAAAGGAAATACTTTTAATGATATTTTT
GACCCTAAATTTTTAAAAATTTTTCCTTAAAAGGTTCACAAGTTATCAAAATTTGGGTCCCTAACAG
>LE_HBa0239A04_T7_399562 (trimmed for quality and cloning vector)
AGGCATGCAAGCTTTAAGGGCAATAAGGTGTAAGTGGTGTAAATTTCATTTAATTTTTCTTTTGAAGATGAGAAGAATGGTAAATTTTTAGGCCAAAGAG
CAAGTCTGAAGTTACAAGAACTCAAGACTTTGTTCCTTCAAACTTGAGTGCCATCGCTGGGGTAAGTTGAAGAGATTTTTAAAAGATAGACGAAATAAAG
ACAGAGTGATAGTTCAACAATTTTTGGTTTTCCCTCTTCATATTCGACACGAATTTTTAAAAAAAAATTATGATGTTCTCCACCTATTTTCTACCCCTAA
GACACTTGAGTTTAATATAACTACCAAAGGAATGGTTGGAGTGGCTACTAGTCGGAAATCTATCAAAATAAGTATACTTCCTAAGATGATCATTTTACAC
CTGTAGAGGTTTTTCTATTGATGTTATGGAAGTACCAAATTGCATAAACATGTGCATTTTTCTAGTTCAGGGCGTATCACTAGTTCAAGAGGAAAACGGA
TATGTTTATGTAATTTTGTACTTCCATAGCTTCCATAACCAAACCGCTTCAGGTGTAAGATCTTCAACATAAAATGGAAAACTAGAAATAGTTGAATTAT
TGGGACAACAAATTTCCATTCTTCATCGTCTTCCGATGAAACAACAGACGAAGTTTTCCCACTTTAACATGATTTCCCTTCAAGTTTTAGTATGCTTAAT
ATTTTTTATAGAAGTTC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.950083
Expected error %
0.299832
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0239A04
Clone
Clone name
hba-239a4
LE_HBa0239A04
P239A04
Clone type
BAC
Contamination
none
Estimated length
96,706
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found