Clone Read LE_HBa0222O03_SP6_399737

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0222O03_SP6_399737
Primer
SP6
ID from Seq. Facility
LE_HBa_222_O03-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
2 trimmed for vector and quality, 1822 raw
Sequence
>LE_HBa0222O03_SP6_399737 (raw untrimmed)
CTGCGGTGGGGAGCATCTTTGGAGAACATCGCCTTCCACGTGTCATCCATCATCCTTCTCATGACACCCATTCACACACATTCAGACCACCCTCTCCCCC
TTTATTTGGGGAACGCCACGCACCCAACAGTGTCTGCGAGAGTGTATTGTGTGAGGCATATGCCTCTTCTCTCACGAGCAGCTGACGAATGAAATTCCGT
AGGCTGAGCACTTTACTTGTGTTGCTCAGGAACTGCGAATGGCAGACCTTCAACGTGAGACTTCGATAACCAAAATATACGGAGTGTGACACCGACGTCT
GGATACAGAAACCACCATTGCCCACATACTCTATTCGCCGCATAACCGACTCTAAGCAGGACACAGCGCTCTATTGTATCACACACGGCGTATGCGCCTT
CGTGTCCATCCACATGCCCCCTCCGCTCATATCCTCATTGTGAGATTTCTCTACTACCGTTCAGCTCACTCGGTAACCCAGCTGGCGGAGCCTTCCAGGC
TTCACGTCATTGAGCCCAACTATATATGCGGCGCAGCACCGATGACTTACGCTCATCGCTATCTGCCCTTTGACAAACCGCGTTGTACTATGACGAGCCA
TGGCGAATACAGCTCTCAAGCCTGCACTGGTTGGGCAGCTCCCTAGCTGTGGGGCGCATACTGCGTGTAATTGTGACAGTCAAGACGATTCTATATACTA
CCTTACTTCGACTGCCCTATACTCCAATGATCGACAGCATGTCAACCACAGCACACAGTCAATCCTAGATAGTCTCACCGACTTTCACCGATAACGGACC
GTTCAAGACAGCATTGATGCCCAGCGTCTCGGAAACTCGGTCCGCAGATACGAATGAGTCGGTATCAATGCTAAGAGTGTTCATAACTACATCAGTACCA
ATAAACTAATCTCGCATGTGATCCGACTTACGCTCTCATTCTATTACGGTGCGCTAGCATACATACTGCCGTTCTATTGTCTACCAGCATCACATTAGTT
CCTGCCAATGAGATATCGTGGTATACACAACTCAGCGTATATCCACTCGCCATATACAACAGCTATGTTGAT
CCTCATGATGTGGCCAGCTCCCCATCGA
AGGCAACAATGAACCGCCACTCCTGAACGACGCAACCATGACTACGGTGTCACACTTACGTAGATCCACGTGCGTGTGCGCCAATTGTCTCATCCCTGCT
CACGCATGACCTCTGTACCCGCGAGACAGTTGAACACTCAACGTCGCTCCCATAACTTACACTTGCTAATACAAGCTCCGNACTGACTTCACCTAACTCA
ACTATCCTCTCTTCTGCTGATACCACCACTATACTCGCTTTTCCATCTACGCGGCTATATCAGCTGCCACTACAGCCCTATCTGCCTGTCAAGCGAGCAT
TACTGAATAGCCAGCACATGTCCGCCACCTCCTATACTCATATCGAGTCGATAATCGAGAGTCATACGTACTACTATCTCCTGCGAACCCGCATGATCAA
TGCACGACTACTACCCGTCCTGCTTTTACCCGNTACGTCCTACATAACGCATGACGACGCCGTCAGCGACTGTTCAATACTATATGCTTTGCTCAGCATA
CGTTACCTCTGCGACACGTCGATGATCTACACTTCATGGCACTCGGTACGTCGACCTACTTATACACTACGTGCACTGTCGACATGCGCGATATTGCACA
CCNCCTGATCTGCCAACCTAACACGGCTCCATTGACTCATTCTCTTCAGTGTACAGACGTGTGACGTACTGTGATGCCAGCACGTGCGACCTGATCTATG
TNACACTCTGCATATCATATTA
>LE_HBa0222O03_SP6_399737 (trimmed for quality and cloning vector)
CC

This is probably not a useful sequence.

Problems:
  • High predicted error rate
  • Low complexity
  • Short cloning insert
Warnings:
  • Not screened for chimera
  • Not screened for contaminants
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
not recorded
Expected error %
5.31548
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0222O03
Clone
Clone name
hba-222o3
LE_HBa0222O03
C03HBa0222O03
P222O03
Clone type
BAC
Contamination
none
Estimated length
151,450
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found