Clone Read LE_HBa0222O03_T7_399739

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0222O03_T7_399739
Primer
T7
ID from Seq. Facility
LE_HBa_222_O03-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
1 trimmed for vector and quality, 2255 raw
Sequence
>LE_HBa0222O03_T7_399739 (raw untrimmed)
GTGTGCGAGTCTCAGTGCTATGTGATACTTAGCCCATGACATGACTTGGTNCGAGATGTGCCATAAGCCANAGAATNCAATGCGTGAATTACCATAGTGA
TGAAACTGGTAGCTCAACGGANACACGCTCCCACACTCACGCTTGCATTGACTCATGATGTTACTTGAGCATGCACTCGCGCTATCGCATCTTCTGTACT
CGGCATCTATGTGATGAACTGCGCTCGTGCGCCTCTGAGCTATCGAGACCCCGAGCAGCTTGCAAAGTGCCTGAAGAGATGGGAACCTGCCGCGCGCACA
CGTTCGTAGACATAACATTACAACAGATCTCCGCTTATCACGAAATAGTAGAGAGAGATTCAATACGAATGGAATGCTACGAATGCTATACCTAGTCACC
CACATAATCTTCCACTCTCATACGGAGATACGAGTCGAGCTGATAAGATGAGCGCGTGACAGTAGCAGCGCTACTCTAAGCACTCTCACTATTGTCCTCG
ACGATGTCGNTGATAGAGCTACGTTTCCACTGTAACACGGCTGTCGAATACCTCGTGCGTGTGGCAGCATTCTGAGCAGTCACCAGATACTGTCAATGCT
TCTGACGAACCGTCACCTACATATAACATAGGGCGAAGAGGTGCGCTGGACACGACTCATGGACAGATGAGGAAGGCACCGACAGTCGATATAAGATAGC
AAAACGCTCTGTCCTTAGACACTAGTCTCATCACTCTTGATAGTGTTAGCTATACGGGGCGACAAATAAAGTAGAAGCAACATTTCGCAGCAGTGAAACA
ATAGGAAGGGAGTCATGGACACTATATTAAATACAGTCTCCTTGTATATACATTACACATTGTACGAGCTCGTATGCCTGTGTATAACGACGAACACATG
ATATGTCACAGATCAAAGTCACGAGACAGTGTCTCATACACTTGCGCCAGCATCAATGAGATGTGTCGGACACGCGGAGGGNATGATAATGTACACAGAA
GCGCACATGGAATGTAAGTACCGTACTCATGAGCCCATTACTCTGCGAGATTACAGAAACATGCGGTTTATGAAGTTCGTAGTGATAGATAATCAAGGCA
TACGTAGCTCGTAGAGCAGATCTAATACGATGCGATACGTCGTCTATCGATGTGACGAAAGACAAGATTCTAACACTCTAATGTTGAAGTGTGTCAGACA
CAGCGTNGGCAATCCTGTCAGATGTGCATATAATTACTGCAACAGCGCAGCGTCGCAATGCCGAGGACATGTGATATGCTTCACGTAGACTCTGCGTATC
CAATTGACTTATAGATTCTGTGCGCTCCATTCTGGCTACACGGAGATAGAATACCTCGACTAGCATGCTGCTGNAGCATGCCACACACGTTCTAGTCACT
AGCATATGAGAACATAGCCGCATCAGNACAATTTGATTCACACAAAGACTGCGGAGATACTCGCCTAGACCTATATCTAGAACACGTGCCTCTCTCGCTA
CTGACATACGCAGATATGCTTGCATGAGCACCACTCCAGCTAAGGCAGANAGGAATGATCTCCATACTACGCGTACGGAAAGCATGATGAAGCAGTCTGA
GTGTGAGTGGGAACACTACCCCTGCCTTGNCCTTCTCCGAATTGTTGAGTATGACATCCAATCGCGCTCATAGAGATCGAGACTCTATGACAGCGTAATG
GACGTGCGTCTGATCACTAATCTGCACATCGGTAGTACTCGTGCACCTGCACATGAGTCATGGATGGATGTACNAGCGACACCAATCGTATGACACGACG
ATATGACTGTCGCGACTACTCAACAATACACAAGTGATGTAGATCACGAGCGAGACTCGCAGATGTGTCGCTCTACGCGTGCGAGTCGACTCGATGACGT
GCTCTGCTCGATCTCACCTCTCTGGAGATATCTTCGCGCGCTGCCTTGAGGCTCTGTCATGACACTCGTGTCACTATAGCACAGTGTCGAGCGCAGCTAG
CGATCAATTCGNCATCACGCACGTACACTTACATTTCGATCTCTTCTCGTATAAGACACTGATCATGTATANTTGTCACTACTGTCGTATCATATCACTA
CGTGTCAGGCAGAGAACACGTCTATTAGCGTCTGCATGGGTGTCAATATGCCCGANATGCCACGACAGTATCATACTATNTGTCATCGACACACTAGCGA
GTGCACTATAACTTCGATGAAGACCCACTGCGCGCTAGGAGACAGATGTGCCTCG
>LE_HBa0222O03_T7_399739 (trimmed for quality and cloning vector)
G

This is probably not a useful sequence.

Problems:
  • High predicted error rate
  • Low complexity
  • Short cloning insert
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
  • Not screened for contaminants
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
not recorded
Expected error %
100
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0222O03
Clone
Clone name
hba-222o3
LE_HBa0222O03
C03HBa0222O03
P222O03
Clone type
BAC
Contamination
none
Estimated length
151,450
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found