Clone Read LE_HBa0239G21_SP6_400183

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0239G21_SP6_400183
Primer
SP6
ID from Seq. Facility
LE_HBa_239_G21-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
316 trimmed for vector and quality, 1087 raw
Sequence
>LE_HBa0239G21_SP6_400183 (raw untrimmed)
ACAACATGCTCCCAATCAATCTTCGATGGTTTGCAAGAGGAAAACAAGGCCAAAAACCACATATTCTTTAATTATCTCTTTTTCTTTAATAACCCTGCTG
TCCAGGTATGTTTGTGTGCACCTTGACTGATTCCCAGGGTACCTACTACCTCCGTCCAGCACAAGTACCAAGAAACTTTGCCACCAATGCTTGAATTCTT
AGCATCCGCTGAGATATGAACCTAAGACTTCACGATTCTTAACCAACTTCATAGACCACTAGGCCACACACCCGAGTACATTAACCATTTCTTTAACATT
ATCGTACAATATTAGTTGATTGATCAGGTTTTCCACCTTAGATATGACTATACACTTCATCCGAAATGTTCGCAGTGTCCATCGTGATATATGGTAAAGT
ACCACTTTTGGGCATATGCAGTAGATTATGCTTGCCCAGAGCATAAATGAAAACATATAAGTTTTTCCCTTTATTTTTAGTTTTCATATGTTAATTGAAT
AACTGTAACTATTCAAATGTAACCCTACAAGTAAATTTTCTAAAAGGTAAATGTACCCCATTTTTTTGAAAGAAGAAGGGTAAATAATAATATTTTAATG
AAAAAGCCCACCATTCCAAATGCTTATCTTCCCCCACCTCCAGGGAAAAAATTAAATTTTAAAAAAATAATATTAACCCTAAACAATTTGATCCCCCCTC
CCAAACTGAAGAATTTGGGTCCTCAAGGGAAACAAGGGGGAAAAGTTCTCTGAAAAGAAATCCCTTTTTGGCCAAAAAAAAAAAAAATTCCCCTCAACAA
AATAAAACCCTTGGAAAAAAACCCCCTCTTTAAGAAAATGTGGTTGGGCTAAAACCCAAAATTATTTTTTAATAGTTCGCCTTTTTTTTTTGGGAAAGTT
TTTTTGAAAAGATTATAAATATTTTTTATATTTTTCAACGGGGAAAAATATTCCTCCCCCCTTTTAAAAACAAAAAAAAAAAGGTAATTCGTGGGATATC
GGGGGTATATTCCTCTTAAAAACCCCAGGGGGGGAAACCCCCCAAGGGGGAGAATAAATTAATTTTAACCCCCGCGCCTAAAAATCN
>LE_HBa0239G21_SP6_400183 (trimmed for quality and cloning vector)
ACAAGGCCAAAAACCACATATTCTTTAATTATCTCTTTTTCTTTAATAACCCTGCTGTCCAGGTATGTTTGTGTGCACCTTGACTGATTCCCAGGGTACC
TACTACCTCCGTCCAGCACAAGTACCAAGAAACTTTGCCACCAATGCTTGAATTCTTAGCATCCGCTGAGATATGAACCTAAGACTTCACGATTCTTAAC
CAACTTCATAGACCACTAGGCCACACACCCGAGTACATTAACCATTTCTTTAACATTATCGTACAATATTAGTTGATTGATCAGGTTTTCCACCTTAGAT
ATGACTATACACTTCA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.937779
Expected error %
0.563635
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0239G21
Clone
Clone name
hba-239g21
LE_HBa0239G21
C08HBa0239G21
P239G21
Clone type
BAC
Contamination
none
Estimated length
112,626
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found