Clone Read LE_HBa0223C15_SP6_400186

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0223C15_SP6_400186
Primer
SP6
ID from Seq. Facility
LE_HBa_223_C15-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
1 trimmed for vector and quality, 1821 raw
Sequence
>LE_HBa0223C15_SP6_400186 (raw untrimmed)
TGTTTGGGTCCCCCCAAATTGCGAGTNANATTCTTCTTACTATCATCATCATGTAATACTACTTAGAAGTATATACAACCCCCCCCATTTTATATAGGTG
GGCGCACATTGTAGTAATAATGATACTCCTGACACAATGATGAGTGTGTTATCATCCCCCCTTTCTTCATGATGTGGTCACCGTGGATCTGCTTTAGTAC
GGGTGAGCTATTCCTTTTCCGTAGAGACCGAGCATATCAGTACACATTCATAGATCGCGAAGTATACGACGCGACGTAGTATTACAGTAAGAGAGTGCTC
ACAGGTCTGAAAGATGATACATGGGACAAAAATTGAAACTCTAGATAATCGGGATACTGTTTACATACGGGCTAAATAGTATCTCGCATGTCTGCAGCCA
TGTGCTTACGTGTTGACTGTCTGGCTCTATAGATTTGCGTGGTTATAAATCGCTCGCTCCATATATAAGAGCGCCTTACAAATGGAATGTATGTGAGTGA
CAACGAATGATGACCTTTACGAACGTGTATCGATAGGTCTGATGATTATAATCAATACGATGGTATGCTGTTCGTCGCATTCATAATTAGAAACTCAGTG
TATGTCCTCACAGCATATATACCAGGCTCACTGATATACGATACTCCATTAGATACCGTTCACTTACGTAAAGAGTGTGACCGGGCGAATCCGTTTAGAC
TCTCCCTAGATTACGTATAACTGTGAGTGACATAGTATGATAGTAAAAGATGGGAATTAGTGTTAGTTCGGTTCGCTAACTATTGTTTGTCCCGGAAGCT
ATGCATGAGCTGTAGTAATCTCTGGTTGATGTTAATGTTACACTTATCTTAAACTATAGTAACAACTGGTTTCTTACAGAATACTGTGATTCCTGCTTTA
GTAGTATATTTTGTGCTATGCGATACACAGTTTCGGAAAATATCATTATCACGGATTGTCTCGTGAGATTATATAGCCCTATGCAACGGTAGATCTAACT
TCAATAGATGCATTGAGTAGTTATAATACACAAATGGCACCTAATTGTCTTTTTGTGAATAGCGATTATCACATAATCTCTACTGTACGTCCGCTCTTTG
TTCTGTAGTACGATGCACTAATTAAATTTGCTAACCCTCTGAGCTGGATATCATCCAGCACTTGTCACAACCTCTTGATTGTGGTAACGCAATCTTATAT
CGTCTTGCAACGTCTAGTCACTTTATTCTCGGATGACAATATTCATAATGTCTTCTCTGCTAATAAACTCTGGATACTAGTTGTATCGAGTCACCTTTAT
CTATACTACTATTACATATTAACTAGTTTCTGTTCGCCAAACTGATGATTATCAAAGCACTAATAGTTACATACGGTGGCATCGACCATAGAATGACACT
CGATCTATACTATCTTACTTCTATATGTGTGAACGTGGCAAATGGTGTACCCATAAGATAGTATGAAACACCTAGTACAGTATTCGACGGCGTGTATATT
CATATACAATTCAATGCCATGACGTCCGTTTGGATATCATTTAATACGGACACATCTTGCATTCAATTAGCTACACTGCTCAATGATGATAGCGCCTACT
AATTCTATGCAACCGAGTTGTACTGGGTATGTGTTTCGGATCAGACAATCTTGTCTACTCTGAAATATATCACAAGTGATCTTATTTTTTATAATTCTGT
CAACAATGTATATTAGAAAAACTCTCTTTCTAGTGTTATATCTATTGCTGCTCAACATATGTTCTCACAGAACTTACTTTGGCATATACACTGTGTCATA
TCCAACACTACTCCTTGAGCG
>LE_HBa0223C15_SP6_400186 (trimmed for quality and cloning vector)
T

This is probably not a useful sequence.

Problems:
  • Low complexity
  • High predicted error rate
  • Short cloning insert
Warnings:
  • Not screened for chimera
  • Not screened for contaminants
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
not recorded
Expected error %
100
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0223C15
Clone
Clone name
hba-223c15
LE_HBa0223C15
P223C15
Clone type
BAC
Contamination
none
Estimated length
137,960
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found