Clone Read LE_HBa0223C15_T7_400188

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0223C15_T7_400188
Primer
T7
ID from Seq. Facility
LE_HBa_223_C15-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
644 trimmed for vector and quality, 945 raw
Sequence
>LE_HBa0223C15_T7_400188 (raw untrimmed)
GAGGTAGAGATATATTGAACGCTAGGCAATTTGATGAATACAGGGTATATCAATTCATAGGTATTCAACATAAGACAAGTATATTCTAACATACACCTAA
TACTTTAAATATTCAAACTCTTAACATTGCATACTGACAACTTCCATTCTTTTGAAAAAAAAAAGAGCATTCTACTAAATTTAGGAAATTTTCATCAAAT
CCATAGTAGTAAATTCTCTATAGAATAATTTTTCATACGGAGAAAGTAGATAACAGTTGGTTGGTTGAAATCCTCTTAGTAGTTTTTCACCAGAGAGACA
TGGAATAGTCACCTTCTTAAATGACAGAGAACAAAGAAACTTACGAAGCAATCGTTGTTAAAAAAAAAAAAAAAAAAAACTTACAAAGCAATGACAACAT
TTTCCAACCTTGCAGCACCAAAGAATGGAACCTACAAAATTTAGTACAGAATTTCACCCAATAAAGGTTCACATGCAAATCTAGACCCCACTTTGTGGAA
CTACACTGGGTATTTTGTTGTTGAAAGGTGTATATGCAAATTGAGAATGACAACAGCAGGAAGATAATATCAGGACAATGAACAATAAAGTTCAAAAAAT
TGCACAGAAGACGAGAAGGGAGGAATTGAACATGTGCAACATGCATATAAAGATTTTCTGTTTAATTTGGAGAGTGCCTTGAATGGTGGTTGGTCATCAA
TGTTCTCCACAATAATTCTCTAATCGGGTCTTTGAAGATAGATATAGAAGAAGCCTATTAAAAAGATGCATTTTAAAAAAATAACCGAAATTAAAGTCAA
GTTTAAAAAAACTTGTAAATGAAAGAACATTAAAGGGGCCCCCCCCCCAAGGTTGGCTTCATCCAAGGGGGAAAAAATTTTAAAAACCCTAACCCAATTT
CCAAGTTTTTTTGAGTTTGGAGCCGGTGTCAACTTTTTCAAATCC
>LE_HBa0223C15_T7_400188 (trimmed for quality and cloning vector)
TAGGCAATTTGATGAATACAGGGTATATCAATTCATAGGTATTCAACATAAGACAAGTATATTCTAACATACACCTAATACTTTAAATATTCAAACTCTT
AACATTGCATACTGACAACTTCCATTCTTTTGAAAAAAAAAAGAGCATTCTACTAAATTTAGGAAATTTTCATCAAATCCATAGTAGTAAATTCTCTATA
GAATAATTTTTCATACGGAGAAAGTAGATAACAGTTGGTTGGTTGAAATCCTCTTAGTAGTTTTTCACCAGAGAGACATGGAATAGTCACCTTCTTAAAT
GACAGAGAACAAAGAAACTTACGAAGCAATCGTTGTTAAAAAAAAAAAAAAAAAAAACTTACAAAGCAATGACAACATTTTCCAACCTTGCAGCACCAAA
GAATGGAACCTACAAAATTTAGTACAGAATTTCACCCAATAAAGGTTCACATGCAAATCTAGACCCCACTTTGTGGAACTACACTGGGTATTTTGTTGTT
GAAAGGTGTATATGCAAATTGAGAATGACAACAGCAGGAAGATAATATCAGGACAATGAACAATAAAGTTCAAAAAATTGCACAGAAGACGAGAAGGGAG
GAATTGAACATGTGCAACATGCATATAAAGATTTTCTGTTTAAT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.91887
Expected error %
0.161273
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0223C15
Clone
Clone name
hba-223c15
LE_HBa0223C15
P223C15
Clone type
BAC
Contamination
none
Estimated length
137,960
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found