Clone Read LE_HBa0117J22_SP6_40026

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0117J22_SP6_40026
Primer
SP6
ID from Seq. Facility
LE_HBa_117_J22-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
774 trimmed for vector and quality, 855 raw
Genbank Accession
Sequence
>LE_HBa0117J22_SP6_40026 (raw untrimmed)
GGGGGGTGGGGTTGGGATCACCTCACCTTCAGGGGACAACAATCTACTCTGATCTATAAGCTTTGGTGAAACTGATTTGAAACAATTGAAGATAATTCTC
ATCTGCAAAAAAATGTGCACATTCCACAGCATGAGAACAGGCACTCCTAGAGCACTATATATGGGAGAGTAAGACCCAAAATATTTTATTTGGAAAAACA
GCGAGAAAGTAAATTACATAGCAATGACTAGGCTATGAATTATTTTGCGAGTTGAGCAAACAGAGATACCCTTATATAATTACCCACCTGCATATCCTCC
ACATGAAGGGAAATCTTTCCCATTGTCTTAAGCAAATAAGAAATGACCAAGTAGCGCTGGCCTTCATCTTCTTGATCACTAAGGTCAGACACAAGAGACA
AATAGATGTTTTTCCCTTTCCTTGAATCAAGCTGTTGAAAAGCCTTAAGTAGAAGACCCTGCTCGTCATGTTCAATGGTGGACCAGAACTTATCTTTACA
TTCAGTTTTTCCTAAGAATGAATGCAGAGAGCAAATTGAAAATACAAGATTTTGAGTAATGAGATCACTGGCAGCATCATCAGTCTGCAACACCTTCAGT
TGGCAACAAAGAGAAGTAGCTATGAAGAAAAGTCTACTTGGCCTCATCAAAAAGTAAGTTCCTTGTGGCAGTTCAAGGTTTTCTTTACAAGCCTCAGTCA
CAGTGGCAAAGTAGCAAGCCACAAGACGGTTTGATATGTTGCGCAACCACAGATGCGGATGCAAAAGCAACTCACAGATTGCTTCCCACAGATCCTATGA
GATGTCGGTAAAATAATAGTCAGAAAACAATAAGAATTTATCCCAGAACAGGACA
>LE_HBa0117J22_SP6_40026 (trimmed for quality and cloning vector)
GGGGACAACAATCTACTCTGATCTATAAGCTTTGGTGAAACTGATTTGAAACAATTGAAGATAATTCTCATCTGCAAAAAAATGTGCACATTCCACAGCA
TGAGAACAGGCACTCCTAGAGCACTATATATGGGAGAGTAAGACCCAAAATATTTTATTTGGAAAAACAGCGAGAAAGTAAATTACATAGCAATGACTAG
GCTATGAATTATTTTGCGAGTTGAGCAAACAGAGATACCCTTATATAATTACCCACCTGCATATCCTCCACATGAAGGGAAATCTTTCCCATTGTCTTAA
GCAAATAAGAAATGACCAAGTAGCGCTGGCCTTCATCTTCTTGATCACTAAGGTCAGACACAAGAGACAAATAGATGTTTTTCCCTTTCCTTGAATCAAG
CTGTTGAAAAGCCTTAAGTAGAAGACCCTGCTCGTCATGTTCAATGGTGGACCAGAACTTATCTTTACATTCAGTTTTTCCTAAGAATGAATGCAGAGAG
CAAATTGAAAATACAAGATTTTGAGTAATGAGATCACTGGCAGCATCATCAGTCTGCAACACCTTCAGTTGGCAACAAAGAGAAGTAGCTATGAAGAAAA
GTCTACTTGGCCTCATCAAAAAGTAAGTTCCTTGTGGCAGTTCAAGGTTTTCTTTACAAGCCTCAGTCACAGTGGCAAAGTAGCAAGCCACAAGACGGTT
TGATATGTTGCGCAACCACAGATGCGGATGCAAAAGCAACTCACAGATTGCTTCCCACAGATCCTATGAGATGT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.959095
Expected error %
0.116341
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAB79817.1| Score 96 E Value 1e-18 Identity 14.80% Align. Length 365bp (47.16%) Frame 3
putative protein [Arabidopsis thaliana] emb|CAA18194.1| putative protein [Arabidopsis thaliana] pir||H85362 hypothetical protein AT4g30990 [imported] - Arabidopsis thaliana
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0117J22
Clone
Clone name
hba-117j22
LE_HBa0117J22
P117J22
Clone type
BAC
Contamination
none
Estimated length
67,891
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found