Clone Read LE_HBa0223D15_T7_400290

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0223D15_T7_400290
Primer
T7
ID from Seq. Facility
LE_HBa_223_D15-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
672 trimmed for vector and quality, 942 raw
Sequence
>LE_HBa0223D15_T7_400290 (raw untrimmed)
GCAGGCTGCAAGCTTCAAAATGTTTTTTTTAATTATTCTCTTATTAATCTCACACTTTTATGACTTTTAGATAATACACATATGTTTTACGTAAATGCAT
ACAATTAGTATCTTTTATGAGTATTTAAAAATCGTTTAAAAAGATTTCAATTTTTGCTTAAACAAATTTAGTTTTTCTAAATTAGTATCTTATGTTTTGA
GCCCTTGGTTTATAATTGAGTTAGTTGTTTTTATCTTGTTAAAAATTAAGAAGCTCGTTAATTAATTGATTAATTCATCTTATTCATGTTTTGAGTAAAT
TCCTTAAGCTAATCTTGATTCGACCATTTTCTAAATCCAAAGGTAGCTCATTTCCCTAAACCCATTAAATGTAAATTTAAGGTCAAATTGTATCAACCAT
TTATTTGAAGCCTCTAACCTATCCATTCTAACAAAATTCAGGGCCCAATTTTGACCAAAGCATTTGCTTCACAAATGATCCATCCCAGCCCACCAATTTT
TTTATCACAAGAGGCCCACCACTATTTTCCATCCTTCTCAATTACAGCACCCAACCCATCTTTCCCATTTCACCATGCTCAACCCACTAAATTTTCTCCA
ACTTACCCTTTCAATAACCCGACCCAACTTATATTTTCTCCCCAAAAGGGACCCAATTCTGGGAAAGCAGCGTCCCAAGAGCGTCTCCAATAACAGCGAT
GCGCAACGAATCCAGCCGCAAACTCGATCGCGCATGACGTGTCTTCCCACCTTTCTTGTCCGGCTGTACGATCTTCAAAGGAAGCAGCATACTCCTATGA
AGGAATAGGGAAATGGGCGTTATCTCTCCCTCCCTCTCACCCTGAAAACCAAAACAACGCCTCTCAGCTTCGTACCATTGAAAACTGACCAAAGCCCGTA
CAAAAACAGGAATCTTCCTCCTTAAACAAATTTTTTCGAAAT
>LE_HBa0223D15_T7_400290 (trimmed for quality and cloning vector)
GCAAGCTTCAAAATGTTTTTTTTAATTATTCTCTTATTAATCTCACACTTTTATGACTTTTAGATAATACACATATGTTTTACGTAAATGCATACAATTA
GTATCTTTTATGAGTATTTAAAAATCGTTTAAAAAGATTTCAATTTTTGCTTAAACAAATTTAGTTTTTCTAAATTAGTATCTTATGTTTTGAGCCCTTG
GTTTATAATTGAGTTAGTTGTTTTTATCTTGTTAAAAATTAAGAAGCTCGTTAATTAATTGATTAATTCATCTTATTCATGTTTTGAGTAAATTCCTTAA
GCTAATCTTGATTCGACCATTTTCTAAATCCAAAGGTAGCTCATTTCCCTAAACCCATTAAATGTAAATTTAAGGTCAAATTGTATCAACCATTTATTTG
AAGCCTCTAACCTATCCATTCTAACAAAATTCAGGGCCCAATTTTGACCAAAGCATTTGCTTCACAAATGATCCATCCCAGCCCACCAATTTTTTTATCA
CAAGAGGCCCACCACTATTTTCCATCCTTCTCAATTACAGCACCCAACCCATCTTTCCCATTTCACCATGCTCAACCCACTAAATTTTCTCCAACTTACC
CTTTCAATAACCCGACCCAACTTATATTTTCTCCCCAAAAGGGACCCAATTCTGGGAAAGCAGCGTCCCAAG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.920551
Expected error %
0.50942
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0223D15
Clone
Clone name
hba-223d15
LE_HBa0223D15
P223D15
Clone type
BAC
Contamination
none
Estimated length
139,910
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found