Notice: SGN will be briefly unavailable for maintenance. Apologies.

Clone Read LE_HBa0239L02_SP6_400576

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0239L02_SP6_400576
Primer
SP6
ID from Seq. Facility
LE_HBa_239_L02-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
656 trimmed for vector and quality, 947 raw
Sequence
>LE_HBa0239L02_SP6_400576 (raw untrimmed)
CAGTAGACATCTTTAGTTATTCAGGTTATCTTGCCCTTCTTTCCGGTATCCATCATTTCAAATGCTTCCTTCATTCCAGCGACTTCCTCCGCAGACAAAA
ACTCAGCTATAACCTGTTTGGAATACAAGAAAGTACATATATCAAGATAAAAAAACGAAACTTGATCAAAATTTTGAGAACCGCCTCTCATTTTTTACGA
TGAGAATTAAGTTTTTATTAAATAGCACAAGGCAGTGCAGTAAATAATTAAGACACAACCTTCTCTCCTTCATTTCGATCTATGAGGAAAAGCATATGAA
TTCATCTTTAGTGGACAGTGAAGAATCCAGAGCTTATAAATATGATTGCAGACTAAGTGTGTGCTTACCGTCAGAGCTTTTTTCTTGAGCTTGTTCATTA
CTGAAAACTGCTTGAGTCTTGCTTTAACAGTCTCACCCAATGAGACGTTTGGTGCTTTCTTTATATTATGTAACCAGGGATGCTCTGCACCACAAGAGTC
AAAGCCCCGGAAAAAAATACTTATCAGAGATAGATAGAGAGAGAGAGAGAGAGAGAGAGAGAGTAAAACAACGAATGAATAAAGTACAATATCTCAATAT
TCCACAAACATTACCAAGAACTTGATGAGCTGTGAGCCGTCGAGTTGGATCTGGATCAAGCATTTTCTTTACAAGATCCTTTTGCATATCAGAAACTTTA
GGCCATGGATCCCTCTTGGAATTCATCCCAGAACGAATAATCGCTTGGGCTACTCCTTGTTCAGTCTCTGCAAATATTCAAGGGAACTTAGGGAAGTATC
CAGAAATATGTTACCTATTTATGCAAGTTTATTTAGCAAAGTTCCAACCCTTAAAAAACCCTTTAAAAGAAACCAAAATAATTGGACCTGGATCTTAATT
GGATTAAAAGCAGGGAAAGGCCTTTTCCCCTACATTTGCCTCCTTCA
>LE_HBa0239L02_SP6_400576 (trimmed for quality and cloning vector)
ATCTTGCCCTTCTTTCCGGTATCCATCATTTCAAATGCTTCCTTCATTCCAGCGACTTCCTCCGCAGACAAAAACTCAGCTATAACCTGTTTGGAATACA
AGAAAGTACATATATCAAGATAAAAAAACGAAACTTGATCAAAATTTTGAGAACCGCCTCTCATTTTTTACGATGAGAATTAAGTTTTTATTAAATAGCA
CAAGGCAGTGCAGTAAATAATTAAGACACAACCTTCTCTCCTTCATTTCGATCTATGAGGAAAAGCATATGAATTCATCTTTAGTGGACAGTGAAGAATC
CAGAGCTTATAAATATGATTGCAGACTAAGTGTGTGCTTACCGTCAGAGCTTTTTTCTTGAGCTTGTTCATTACTGAAAACTGCTTGAGTCTTGCTTTAA
CAGTCTCACCCAATGAGACGTTTGGTGCTTTCTTTATATTATGTAACCAGGGATGCTCTGCACCACAAGAGTCAAAGCCCCGGAAAAAAATACTTATCAG
AGATAGATAGAGAGAGAGAGAGAGAGAGAGAGAGAGTAAAACAACGAATGAATAAAGTACAATATCTCAATATTCCACAAACATTACCAAGAACTTGATG
AGCTGTGAGCCGTCGAGTTGGATCTGGATCAAGCATTTTCTTTACAAGATCCTTTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.95856
Expected error %
0.0462998
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0239L02
Clone
Clone name
hba-239l2
LE_HBa0239L02
P239L02
Clone type
BAC
Contamination
none
Estimated length
92,115
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found