Clone Read LE_HBa0239M09_T7_400699

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0239M09_T7_400699
Primer
T7
ID from Seq. Facility
LE_HBa_239_M09-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
808 trimmed for vector and quality, 864 raw
Sequence
>LE_HBa0239M09_T7_400699 (raw untrimmed)
NTTAAGGGAGGACGGGTTCTCTAAGTCACTGCAGCAGCAAGCTTCTTTGCTATAAAGATTAGTACAGTTGACCCTCCACTACAACTGGAGGGTTACCTAT
CTTCTACATGTTCACAAAACGAATAGATGGCAAAGGAAGACATAGAAAAGGATCAGTAGTTGATGATTGGACAACCTCAACATTTCCAAATCTAATCCTG
AAGCAGCACAATACAGTAATATTCACCTTCATACGACAAATAAAGATACCTGGCATGGTACTAATCCCATTCTGCATAGGAGCCAACGGAACTTTTGGAG
GCACTGGATATTTCATCAGATGATACTGGTGCTCAAGCAAATGATTGAACAGGACGATTTGTTTCTTCAGTTTAAGCCTAATGTAGTAGGCCCGAAAGAA
ATCTGCATTTTCTTCTTCTAATTTTTGCCAAACTGTACACAATTTGAAAAGATATTAAAGTTAGAAACTGAAGATCTAAAGTGACCACCCAATAACCATA
GTCATAGTGTAACTATACATGTGAGACAGTAGACAGCATATATAATGCAAGCAGACAGATTCATAAGCAACTTCATCAGTAACTCATGTACCTACCTAGA
GTTGTGAATCCAGGATCTATCCTTGCACGATTCAGAAGTGTTTTTACGACTTCATCCTTATTCATATACAACTGCAAGCACCTTTCAATCAAGTTTTGGA
CCTGCAACAAATATGTCATCATAAAGTTAAAAGACCCCGGTAAAACTTCCCAATGAATAATATCCAGGCATAATAAAGAACTTAAAGACTGTCTTACAAG
TTCAATATCTTCACGTGAAACTTTTCTGTTATCATTGCCTGATGCAGAAACAGAACCTGCATCA
>LE_HBa0239M09_T7_400699 (trimmed for quality and cloning vector)
CAAGCTTCTTTGCTATAAAGATTAGTACAGTTGACCCTCCACTACAACTGGAGGGTTACCTATCTTCTACATGTTCACAAAACGAATAGATGGCAAAGGA
AGACATAGAAAAGGATCAGTAGTTGATGATTGGACAACCTCAACATTTCCAAATCTAATCCTGAAGCAGCACAATACAGTAATATTCACCTTCATACGAC
AAATAAAGATACCTGGCATGGTACTAATCCCATTCTGCATAGGAGCCAACGGAACTTTTGGAGGCACTGGATATTTCATCAGATGATACTGGTGCTCAAG
CAAATGATTGAACAGGACGATTTGTTTCTTCAGTTTAAGCCTAATGTAGTAGGCCCGAAAGAAATCTGCATTTTCTTCTTCTAATTTTTGCCAAACTGTA
CACAATTTGAAAAGATATTAAAGTTAGAAACTGAAGATCTAAAGTGACCACCCAATAACCATAGTCATAGTGTAACTATACATGTGAGACAGTAGACAGC
ATATATAATGCAAGCAGACAGATTCATAAGCAACTTCATCAGTAACTCATGTACCTACCTAGAGTTGTGAATCCAGGATCTATCCTTGCACGATTCAGAA
GTGTTTTTACGACTTCATCCTTATTCATATACAACTGCAAGCACCTTTCAATCAAGTTTTGGACCTGCAACAAATATGTCATCATAAAGTTAAAAGACCC
CGGTAAAACTTCCCAATGAATAATATCCAGGCATAATAAAGAACTTAAAGACTGTCTTACAAGTTCAATATCTTCACGTGAAACTTTTCTGTTATCATTG
CCTGATGC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.962165
Expected error %
0.127054
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0239M09
Clone
Clone name
hba-239m9
LE_HBa0239M09
P239M09
Clone type
BAC
Contamination
none
Estimated length
18,832
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found