Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Clone Read LE_HBa0223I24_SP6_400815

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0223I24_SP6_400815
Primer
SP6
ID from Seq. Facility
LE_HBa_223_I24-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
614 trimmed for vector and quality, 865 raw
Sequence
>LE_HBa0223I24_SP6_400815 (raw untrimmed)
TCCTTTAAAGTTTATAATCTCTTAGGTAAGGTTTATTGTCTTCTGGAAATCTTATTCTCTTTGTGAAGAAAATGGTAAAATGCACATTTGTATTGATTAT
ATGCAGCAAAATAAGGTGACATTTCTAGGAATGATGATCTATTTTACCAGCTTCAGGGTGCTGTAATATTTTTAAGATTGATCTGAGGTTCGTTACCACT
AGTTGAGGAGTAGAAAAATGGATATCCCTAAAAAACATATATTACTCGATATGGCCATTAGAGTTCGTAGTGATGTCTTTTCGGGTAACTAATGCCTATT
TATACTTCATGGACTTGACAATGCAAATTTTTCGGTAGTATCTTGATTTGTTTATCTTTGTCTTTATTGGGGGTTCTCTAGTATAATCACAGAGTATGGG
TGATCGTGAGCAGCATCGGAGGATTTTGCTCCAGTCTTAGAGAGATGAACAATTTTATACCAAGTTATCAGTGTGGGATCTAGATTATGTCTAAAGCATT
ATCGCGGCACGTTGTTTACAAGGATGGCATCATTACAAATCCGATGAAGATTGATGCTATTCGTGATTGGGATAGGCCTACTTTGGCTACTAAGGTTTTG
AGATTTTTCATATTATTAGGCTACTACAGGATTCTTTTTGTATGGTTTCTCTATTATTGAAGCACCTCGTACCCCATTGATTCGCCTTGATGTTTCCTTT
GAGTATATGAGAGTATGAGTAGAGCTTTCAAAAACCCTAGGAATTATCAACTACTATTCCCATAATGACCCCCCTTTGTGTGGTCAGAATATTATGGCCT
CTTCAAACGCATCCTATGGTTTTTTGGGTGTGTTTATAGTGGGGGTATTTTAATCCTATGGTCGA
>LE_HBa0223I24_SP6_400815 (trimmed for quality and cloning vector)
ATAATCTCTTAGGTAAGGTTTATTGTCTTCTGGAAATCTTATTCTCTTTGTGAAGAAAATGGTAAAATGCACATTTGTATTGATTATATGCAGCAAAATA
AGGTGACATTTCTAGGAATGATGATCTATTTTACCAGCTTCAGGGTGCTGTAATATTTTTAAGATTGATCTGAGGTTCGTTACCACTAGTTGAGGAGTAG
AAAAATGGATATCCCTAAAAAACATATATTACTCGATATGGCCATTAGAGTTCGTAGTGATGTCTTTTCGGGTAACTAATGCCTATTTATACTTCATGGA
CTTGACAATGCAAATTTTTCGGTAGTATCTTGATTTGTTTATCTTTGTCTTTATTGGGGGTTCTCTAGTATAATCACAGAGTATGGGTGATCGTGAGCAG
CATCGGAGGATTTTGCTCCAGTCTTAGAGAGATGAACAATTTTATACCAAGTTATCAGTGTGGGATCTAGATTATGTCTAAAGCATTATCGCGGCACGTT
GTTTACAAGGATGGCATCATTACAAATCCGATGAAGATTGATGCTATTCGTGATTGGGATAGGCCTACTTTGGCTACTAAGGTTTTGAGATTTTTCATAT
TATTAGGCTACTAC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.952451
Expected error %
0.455657
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0223I24
Clone
Clone name
hba-223i24
LE_HBa0223I24
C08HBa0223I24
P223I24
Clone type
BAC
Contamination
none
Estimated length
104,529
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found