Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Clone Read LE_HBa0223I24_T7_400817

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0223I24_T7_400817
Primer
T7
ID from Seq. Facility
LE_HBa_223_I24-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
669 trimmed for vector and quality, 934 raw
Sequence
>LE_HBa0223I24_T7_400817 (raw untrimmed)
CGGGGACTCTGAGTCGACCTGCAGGCAGCAAGCTTGACCGAGAGGTTGTGGGTCCCCTTTAACTCCACTCATTTCTTATTCTTTTCATTTTTTCCTCTAG
CTTGACCGAGAGGTTGTGGGTTCGAATCCCACTCCTCTCATTTCTTATTTTCATATATACTTTATTTTTCAGCCAGGAGCATGGTCTAGTTCCCCCGTAC
CACATTGTTTTTTACTTCTTTATTTCCACCACATTTTTTGTGGTTAGGTCACATGTTCGACCCTCAGTGACCTCACTTATTTTTCTTCGCTTTTCATGAC
ATTTTAAACAACATAAATTGGATGAAATTAATCAACAAGGTGCTTGAAATTTGAGTTACATTTTCAACTTCTTTTCCATTCCAATATTCGATAGTACTTA
GGAGAATTTCATAGTGCATTTAGAACGTTTTAGTTGTGTTTTCATAGTTTCCTTTAAACAAGAGATTTTCACTCAAATCAGCCACATTTCATCTCATATG
AAACTGACGATTTACATAAACATGTGTACATGAAATACAAAGAACTAACATGCCATTTAAATTCCTACACCGTTACCAATAGCCATGACAATGCACCCAA
ACGCTTGTAGTCACATTTTTAGAGAACATAGACATAAGTCACATAATTCCGAACATACATACAAAAATATGGGTATCACTTAAACACGTTTTATCCTATT
TTTCTACCACAAGCATAACAACCTAAAATTCAATGGGATCTAGTGACAGGGACATGAAACGGGGAAAGAACCCTAGTTTTCGGACAAACTATACTGAACC
TTAAGGGGGCTTATTGGGAAAAGGGACCATGGAGAAGAGAACCCCTTCCTTTTATGAAAATTCAACCTTTGAAATTGCTTCCCCAAAATTTCTTCAACAC
TTCAGTTCCAAAAAAAAATTTTCACCCCCCAACT
>LE_HBa0223I24_T7_400817 (trimmed for quality and cloning vector)
AAGCTTGACCGAGAGGTTGTGGGTCCCCTTTAACTCCACTCATTTCTTATTCTTTTCATTTTTTCCTCTAGCTTGACCGAGAGGTTGTGGGTTCGAATCC
CACTCCTCTCATTTCTTATTTTCATATATACTTTATTTTTCAGCCAGGAGCATGGTCTAGTTCCCCCGTACCACATTGTTTTTTACTTCTTTATTTCCAC
CACATTTTTTGTGGTTAGGTCACATGTTCGACCCTCAGTGACCTCACTTATTTTTCTTCGCTTTTCATGACATTTTAAACAACATAAATTGGATGAAATT
AATCAACAAGGTGCTTGAAATTTGAGTTACATTTTCAACTTCTTTTCCATTCCAATATTCGATAGTACTTAGGAGAATTTCATAGTGCATTTAGAACGTT
TTAGTTGTGTTTTCATAGTTTCCTTTAAACAAGAGATTTTCACTCAAATCAGCCACATTTCATCTCATATGAAACTGACGATTTACATAAACATGTGTAC
ATGAAATACAAAGAACTAACATGCCATTTAAATTCCTACACCGTTACCAATAGCCATGACAATGCACCCAAACGCTTGTAGTCACATTTTTAGAGAACAT
AGACATAAGTCACATAATTCCGAACATACATACAAAAATATGGGTATCACTTAAACACGTTTTATCCTA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.937227
Expected error %
0.446624
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0223I24
Clone
Clone name
hba-223i24
LE_HBa0223I24
C08HBa0223I24
P223I24
Clone type
BAC
Contamination
none
Estimated length
104,529
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found