Clone Read LE_HBa0223M04_SP6_401118

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0223M04_SP6_401118
Primer
SP6
ID from Seq. Facility
LE_HBa_223_M04-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
567 trimmed for vector and quality, 887 raw
Sequence
>LE_HBa0223M04_SP6_401118 (raw untrimmed)
CGCTTTAGAATAAAAATGAAAAGTAAAAAGTAATATAAAGTGAGCAGAGTATTATTCTTATGAGAAATTTGGATTAGCTTTCTAATTAAATTAATCTATC
TAAACCTAATTATGAATTTGGACTTTGTAGTAGACAATTAAGTGATTCATGCTTTTGCTTTTTAGTAGCACTAACTTATGTTTATAATTTTTTAATACTA
TACAATTATGCATGATTTCCTGTATTAATTTTTTAATATACTGAGATTCTTTTCTCCACTAACCCCAATCAACAAAAGAGTCTTTTTTAAGCATTAAACC
CAATTTGTGTCATTAGTTATACATAGTTTGTGTTTAGTTCCATAATTTTGAGCTTTCATATATGAAACCAATTAGGAGAGGATATTTTTTTTCTCTATCA
AGTAAAAAGGTTAGTTAATTCATCTACTCTATCGAAGAATATGACAAAAATATTTGATAGTAAGTTCAATCTAGATCTTAAGTTAGATTTTGTTTATGAG
AAAGTAGAAAAATGAAGGTTTTTAGAATCCGTTGAATAAATAATGTGATCTTGTGAAATTCGGATATATATGCTGCCCAATCAGTAAGCTGAAACTTGTT
CCTTCCTACTGCTTGATAGATGTAAAAATGAAATTTGTAAAGTTAAAAATATTTTTAAAAAACTAAACTGGTATGGGTGGGTGGGTAGAGGGCTGGCAGG
GGGTTGGGTTGGGGAATGGTAAAATGAAGTGGGTAAGGGGAGCTTCTTCTATTACCTTTTTATATTTTTATTTTTATCTTTTCACCCTTTTTTTTCCGAT
ACTGGCTCTATTTATTCTTATTTCATAATCTTTTTTACTATTAAAATGATCTTTTTAATTTTTTCATTAATATTTGTACTATTCTCN
>LE_HBa0223M04_SP6_401118 (trimmed for quality and cloning vector)
TAAAAATGAAAAGTAAAAAGTAATATAAAGTGAGCAGAGTATTATTCTTATGAGAAATTTGGATTAGCTTTCTAATTAAATTAATCTATCTAAACCTAAT
TATGAATTTGGACTTTGTAGTAGACAATTAAGTGATTCATGCTTTTGCTTTTTAGTAGCACTAACTTATGTTTATAATTTTTTAATACTATACAATTATG
CATGATTTCCTGTATTAATTTTTTAATATACTGAGATTCTTTTCTCCACTAACCCCAATCAACAAAAGAGTCTTTTTTAAGCATTAAACCCAATTTGTGT
CATTAGTTATACATAGTTTGTGTTTAGTTCCATAATTTTGAGCTTTCATATATGAAACCAATTAGGAGAGGATATTTTTTTTCTCTATCAAGTAAAAAGG
TTAGTTAATTCATCTACTCTATCGAAGAATATGACAAAAATATTTGATAGTAAGTTCAATCTAGATCTTAAGTTAGATTTTGTTTATGAGAAAGTAGAAA
AATGAAGGTTTTTAGAATCCGTTGAATAAATAATGTGATCTTGTGAAATTCGGATATATATGCTGCC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.891847
Expected error %
0.161457
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0223M04
Clone
Clone name
hba-223m4
LE_HBa0223M04
P223M04
Clone type
BAC
Contamination
none
Estimated length
97,995
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found