Clone Read LE_HBa0223M05_T7_401124

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0223M05_T7_401124
Primer
T7
ID from Seq. Facility
LE_HBa_223_M05-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
665 trimmed for vector and quality, 963 raw
Sequence
>LE_HBa0223M05_T7_401124 (raw untrimmed)
GGACGGGGACTCTGAGTCGACTGCAGGCAGCAAGCTTCAACGCTCTCTTATGATGCATCATTATTCCCGATGCCAAGGACCTGTTGTGTCTTGCTTCTGG
TGAATTCCTTCCACTTGACTAGAGGAAAAGCTCTTTTTTCTTTATTTCCTTTCCACAGGAAGGATCTCCTAACCTTGTCCAGCCTTTGAATGACTTTGGG
AGGGATTGAGAATAGGGAAAGCATATAAGTAGGCAAAGCATCCAAGACAACATTAATCAAAGTGAGTCTACCTCTAAAGAACAAATACTGAGATTTCCAC
GTTGTCAATTTCTTCTCACACTTTTCGAATGTTGTGTCCCAGATTCCTTGAGAATTAGATTTTTCTCCCAAAGGCATACCTAAGTATCTTGTTGGTAGGT
TACCCACTTTACCATCTAGAATTATAGCCAGCAGCTCCATATGATGAACATGATTGATAGGATAAAATGTGGATCTTCCTCCAATTGATGTGAATTCCTG
AGATGGCCTCAAACAAAATTAGTATAACTCGCAAGTACTTCAGTTGTTCCTCTTCTTCCCCACAAAATATTGAAGTGTCATCAGCATACTTAAGATGAGT
GATTTCCATTCTTTGTTTATTGTTTTTGGCCACCTCAAAACCCCTGATCCATCGATTAGTACTAGCCACCTTTACCATGCTGTTAAGACCTTCCATGGCT
TAAATGAAACAAACATGNACATGGGGGTCCCCTTGTCCGATCCCTCTCTGAATATTGAAAAACACTTCATTGCCACCCATTACAAGAAATGGAGAACTTA
ACTGGGTAAATACAAAAACTTCACTAAGTTGACCCATTTAGCACAAAAACCCAATGGCCTTAGGACTTTGCCAGAAAAATTCCCAATTTGACTTGATCAT
AAGGTTTTCTCCATGGCAAGGTTTGCCTAAAAATCCCTGGGTTTCCATTGAAAATTTTTTTTA
>LE_HBa0223M05_T7_401124 (trimmed for quality and cloning vector)
AGCTTCAACGCTCTCTTATGATGCATCATTATTCCCGATGCCAAGGACCTGTTGTGTCTTGCTTCTGGTGAATTCCTTCCACTTGACTAGAGGAAAAGCT
CTTTTTTCTTTATTTCCTTTCCACAGGAAGGATCTCCTAACCTTGTCCAGCCTTTGAATGACTTTGGGAGGGATTGAGAATAGGGAAAGCATATAAGTAG
GCAAAGCATCCAAGACAACATTAATCAAAGTGAGTCTACCTCTAAAGAACAAATACTGAGATTTCCACGTTGTCAATTTCTTCTCACACTTTTCGAATGT
TGTGTCCCAGATTCCTTGAGAATTAGATTTTTCTCCCAAAGGCATACCTAAGTATCTTGTTGGTAGGTTACCCACTTTACCATCTAGAATTATAGCCAGC
AGCTCCATATGATGAACATGATTGATAGGATAAAATGTGGATCTTCCTCCAATTGATGTGAATTCCTGAGATGGCCTCAAACAAAATTAGTATAACTCGC
AAGTACTTCAGTTGTTCCTCTTCTTCCCCACAAAATATTGAAGTGTCATCAGCATACTTAAGATGAGTGATTTCCATTCTTTGTTTATTGTTTTTGGCCA
CCTCAAAACCCCTGATCCATCGATTAGTACTAGCCACCTTTACCATGCTGTTAAGACCTTCCATG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.957567
Expected error %
0.210893
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0223M05
Clone
Clone name
hba-223m5
LE_HBa0223M05
P223M05
Clone type
BAC
Contamination
none
Estimated length
100,993
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found