Clone Read LE_HBa0241I08_T7_402629

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0241I08_T7_402629
Primer
T7
ID from Seq. Facility
LE_HBa_241_I08-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
790 trimmed for vector and quality, 871 raw
Sequence
>LE_HBa0241I08_T7_402629 (raw untrimmed)
CTGACGGGGACTCTGAGTCGACTGCAGGCATGCAAGCTTTGCAACCAAATACTCTCAACCGGTCATAGGAAATATCCTTTCCATACCTAACACTAGTTGG
TATATAACTTTGCAAAGCCATAGCAGGAGATAGATTAATAACATATGCAACGGTCAATAAAGCCTCACCCCAAAATGAGTTCGTCAACTTTGATTCAGAA
AGCAAACATCTAAATCACTCCATCAATGTCCTATCCATTCTCTCAGCCAAACCATTAAGTTGAGGAGTTTTGGGAGGAGTCTTCTGGTGTCTAATACCTT
GATGCTTGCAGTATTTGTCAAATGGTTCACAATATTCATCACCATTATCAGTACGAATGCACTTCAATTTCTTTCCAGTTTTGCTTTCAACTGAAGCCTG
AAACTGCTTAAAGACACCTAACACTTGGTCTTTAGTCTTCAAGACATAAGCCCAAAGTTTTCTCGAGCAATCAGCAATGAAGGTGACAAAGTAGACTGCA
CCACCCAATGTCTTTGTCTTCATTGGACCACATAAATCAGAGTGCACCAACTATAGCAACTCTGTCTTTCTCGAAGGAGGGTAGGACTTAAAGGAAACTC
TATTTTGTTTACCATCCAAGCAATGTTCACACTTTTCTAATTTAGCACTTAAGAAATTTGACAAAAACCTCCTCTTGGCTAGAACATTAAGTCCTTTCTC
GCTAATGTGTCTAAGTCTCTTATGCCATAACGTTGAATATTTATCACTCTCAACCGCAGTCACCATATCAACACAAGTAGAGGTCGTAGTCTCGTATAGA
CCATGACATTTGTTACCACGAGCCACAACCAAGGAACCCTTAATGAGCTTCCATTTTCAATCACCGGTGGT
>LE_HBa0241I08_T7_402629 (trimmed for quality and cloning vector)
CTGCAGGCATGCAAGCTTTGCAACCAAATACTCTCAACCGGTCATAGGAAATATCCTTTCCATACCTAACACTAGTTGGTATATAACTTTGCAAAGCCAT
AGCAGGAGATAGATTAATAACATATGCAACGGTCAATAAAGCCTCACCCCAAAATGAGTTCGTCAACTTTGATTCAGAAAGCAAACATCTAAATCACTCC
ATCAATGTCCTATCCATTCTCTCAGCCAAACCATTAAGTTGAGGAGTTTTGGGAGGAGTCTTCTGGTGTCTAATACCTTGATGCTTGCAGTATTTGTCAA
ATGGTTCACAATATTCATCACCATTATCAGTACGAATGCACTTCAATTTCTTTCCAGTTTTGCTTTCAACTGAAGCCTGAAACTGCTTAAAGACACCTAA
CACTTGGTCTTTAGTCTTCAAGACATAAGCCCAAAGTTTTCTCGAGCAATCAGCAATGAAGGTGACAAAGTAGACTGCACCACCCAATGTCTTTGTCTTC
ATTGGACCACATAAATCAGAGTGCACCAACTATAGCAACTCTGTCTTTCTCGAAGGAGGGTAGGACTTAAAGGAAACTCTATTTTGTTTACCATCCAAGC
AATGTTCACACTTTTCTAATTTAGCACTTAAGAAATTTGACAAAAACCTCCTCTTGGCTAGAACATTAAGTCCTTTCTCGCTAATGTGTCTAAGTCTCTT
ATGCCATAACGTTGAATATTTATCACTCTCAACCGCAGTCACCATATCAACACAAGTAGAGGTCGTAGTCTCGTATAGACCATGACATTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.965307
Expected error %
0.324773
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0241I08
Clone
Clone name
hba-241i8
LE_HBa0241I08
P241I08
Clone type
BAC
Contamination
none
Estimated length
100,193
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found