Clone Read LE_HBa0227C07_T7_403227

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0227C07_T7_403227
Primer
T7
ID from Seq. Facility
LE_HBa_227_C07-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
624 trimmed for vector and quality, 934 raw
Sequence
>LE_HBa0227C07_T7_403227 (raw untrimmed)
TCGACTGCAGGCTGCAAGCTTATTAAAGATAGTATTGACTTCATGGGAATAAACCACTATGGCACTCTGTATGCGAAAGATTGCATTAATTCTAGCTGCG
TTTGCTCCAATTCTAGTTGCATCGCGGGTGGAGACCACCCTATCCATGGCTATCTCATTACTCTAGGAGAGAAAGATGGCGTTTCTATTGGAGAACCGGT
ATGAAGTTGTTTTTGTAATCCTTAAACTCTGCTTTCTCTCGTCATGATACGCGTACTGTCCTGTTCTCCATAGACAGGAATGTCTCGATTTTTCGTGGTT
CCAAATGGAATGGAGGAGATTGTTGACTATATGAAGAAGAGATACCATAATAAACCTATGTTTGTTACTGAAAATGGTAAACCATCGTAGCCTCGTTTAC
CTTGCATATTCATAATTTTGTGGGGAAAAAACTGATCTATGAGGTACATTGCAGGCTACGCCTCTCTGAATCCTACTACAGCACAAGCGGATGAGCTACA
ACATGATACTAAGCGAGTTGAATTCCATAAGTCATATCTTGCATCATTAGCTCGAGCAATCAGGTAAAATGTACCAAAACAATAGGTTGCCTGAATCATG
ACTCAACCAACCCAAAATGATGAAATCTTTGTTTTCTTCGAATGACATTTACAGGAAGGGCGCTGATGTACCTGGTTATTTCATTTGGACCCTGATGGAT
AATTTCGAGTGGACTAGTGGATACCAACTCAAATTTGGGTTAATCTACCTTGATCGCCATACCTTAAATCGAGGTTCCAAGCTTTTCGCCAAAATGGTAT
ACCAATTTCCTGATCTACAAGAGCCTCAATGGTGAAAAAAAAGGAACCTTTTTCCCATTTCAGTTTACTTCCCAACCCAATTCTTCCTTCCCCCCAAATA
GGACCTTTAAAAACCATTATTTGGTCAAAAAATA
>LE_HBa0227C07_T7_403227 (trimmed for quality and cloning vector)
TGCAAGCTTATTAAAGATAGTATTGACTTCATGGGAATAAACCACTATGGCACTCTGTATGCGAAAGATTGCATTAATTCTAGCTGCGTTTGCTCCAATT
CTAGTTGCATCGCGGGTGGAGACCACCCTATCCATGGCTATCTCATTACTCTAGGAGAGAAAGATGGCGTTTCTATTGGAGAACCGGTATGAAGTTGTTT
TTGTAATCCTTAAACTCTGCTTTCTCTCGTCATGATACGCGTACTGTCCTGTTCTCCATAGACAGGAATGTCTCGATTTTTCGTGGTTCCAAATGGAATG
GAGGAGATTGTTGACTATATGAAGAAGAGATACCATAATAAACCTATGTTTGTTACTGAAAATGGTAAACCATCGTAGCCTCGTTTACCTTGCATATTCA
TAATTTTGTGGGGAAAAAACTGATCTATGAGGTACATTGCAGGCTACGCCTCTCTGAATCCTACTACAGCACAAGCGGATGAGCTACAACATGATACTAA
GCGAGTTGAATTCCATAAGTCATATCTTGCATCATTAGCTCGAGCAATCAGGTAAAATGTACCAAAACAATAGGTTGCCTGAATCATGACTCAACCAACC
CAAAATGATGAAATCTTTGTTTTC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.975363
Expected error %
0.124556
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0227C07
Clone
Clone name
hba-227c7
LE_HBa0227C07
C07HBa0227C07
P227C07
Clone type
BAC
Contamination
none
Estimated length
100,983
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found