Clone Read LE_HBa0242F06_T7_403884

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0242F06_T7_403884
Primer
T7
ID from Seq. Facility
LE_HBa_242_F06-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
808 trimmed for vector and quality, 859 raw
Sequence
>LE_HBa0242F06_T7_403884 (raw untrimmed)
ATCGTCGGGGATCTCTGAGTGACCTGCAGGCATGCAAGCTTCGCATGTCGTTTTAACACCCGTGTTCCTTGACCAATGTCTAGTGGAGAACCCTTTTTGA
TTGACCTATTCACCACTTTGATAGCCCGTCAACCTCACCGTGGGCCATATAAGCGTCCGTCAAAGTGAAACCTGTATAAGGAAGGTTTTAGAAACCTACA
TGAGCCCCATAACAGACCCTAGTCCCTTTCACGGCCCGTCTGGGCTCTATAGAGGGTTCCATGGTCCACTTTTTGGGCTTGTGAGTTTCCAACTTGACCC
ATTTCTACACTTTGCTCAAATCTGAGGTGTTACAATTGCATATATGTTGGTCCGTTAAATCTAGTTCCTACACTCCTAATGATGTTTTGAATTCTATTTG
AGAATGAATGTTTCCAAGGAGGAGATATCATAACACCTCATATTGAAAATAAGGAAACTTACAGGTTTTCTAGAAATGGTGTGTGTAGCGACATACATAG
GTGGCAAGTCAAAATATTTTCAATGTCAAGTTCCAATACCCTTTTTATGGTTCACAGGGATGGTCCATATTTCAATGGACGAGTCGTACTTAAGTCTCGT
AGGTGAGTACCAGACTTACTAAATTATAAGGGCCAAAGTTGGACTTACAGTGACAATGTACGGGTCGTAAGTTGACCAACTTACCGTACATGGGTTCCGT
CATTCAAGGGTCCAGAAACAAGTTCCTAAACCCCACAAAGATTAACTAGGATGGTCCATAAATAGACTTACGGACCGTAGGTCCCACCGTTGATGGTGGT
CGGTAGTAATTTTTAAAGAAGTCATTGGGTCTTTTACTAGATTATTTAACACAATACTA
>LE_HBa0242F06_T7_403884 (trimmed for quality and cloning vector)
CTGCAGGCATGCAAGCTTCGCATGTCGTTTTAACACCCGTGTTCCTTGACCAATGTCTAGTGGAGAACCCTTTTTGATTGACCTATTCACCACTTTGATA
GCCCGTCAACCTCACCGTGGGCCATATAAGCGTCCGTCAAAGTGAAACCTGTATAAGGAAGGTTTTAGAAACCTACATGAGCCCCATAACAGACCCTAGT
CCCTTTCACGGCCCGTCTGGGCTCTATAGAGGGTTCCATGGTCCACTTTTTGGGCTTGTGAGTTTCCAACTTGACCCATTTCTACACTTTGCTCAAATCT
GAGGTGTTACAATTGCATATATGTTGGTCCGTTAAATCTAGTTCCTACACTCCTAATGATGTTTTGAATTCTATTTGAGAATGAATGTTTCCAAGGAGGA
GATATCATAACACCTCATATTGAAAATAAGGAAACTTACAGGTTTTCTAGAAATGGTGTGTGTAGCGACATACATAGGTGGCAAGTCAAAATATTTTCAA
TGTCAAGTTCCAATACCCTTTTTATGGTTCACAGGGATGGTCCATATTTCAATGGACGAGTCGTACTTAAGTCTCGTAGGTGAGTACCAGACTTACTAAA
TTATAAGGGCCAAAGTTGGACTTACAGTGACAATGTACGGGTCGTAAGTTGACCAACTTACCGTACATGGGTTCCGTCATTCAAGGGTCCAGAAACAAGT
TCCTAAACCCCACAAAGATTAACTAGGATGGTCCATAAATAGACTTACGGACCGTAGGTCCCACCGTTGATGGTGGTCGGTAGTAATTTTTAAAGAAGTC
ATTGGGTC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.98504
Expected error %
0.268709
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0242F06
Clone
Clone name
hba-242f6
LE_HBa0242F06
C02HBa0242F06
P242F06
Clone type
BAC
Contamination
none
Estimated length
100,069
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found