Clone Read LE_HBa0242F12_SP6_403906

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0242F12_SP6_403906
Primer
SP6
ID from Seq. Facility
LE_HBa_242_F12-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
632 trimmed for vector and quality, 769 raw
Sequence
>LE_HBa0242F12_SP6_403906 (raw untrimmed)
CTTTATACACACCCGCTGTCTCTCAGTCCGGGACCCATGGAGGACATATCTGTCCATGCATCTATCGCAGCGCACGACACAACCCTCGATAATAATAACC
ATCACGGCGCGCGATACGACCCTCGAAATATACATCCTTATACCACAATCATGTCTCAGATACAATGCAATTGACATGCTTAAATGAAAATGAGGAGATA
ACCATTTTGATAACAAAGCACGATTTACAACCAGGAATACAACACCAACAAATAAGCAACAAGTCTCCAAGTCATTCTCAACACCACACAAAGAAATACA
CGAATTTCACACGCTTAACAAGGGTTTAGAAATCCACTTGCCTCAATCAATCCAGAACTCACTCTGGGACTTGAGTCTTTCCCTTTCGTTGAACTTCCAA
CTCAAAGCAATCTATTCACATTAATAATCACAATAAGATTTCAAAACTAATAACACTCACCTTATTATGTGTTTAGCCTTGCACCAAAAATTTACTCAAT
TTTATATTCAAGTTCGTAAATCATCATGCCAATTAACATTTTAACTATCATATTATTTTTTTTCAAATTTCAAGTCTAAGGTTTAATCTCAATATCACCA
ATTAAAATAATTTTATCACACAAATATATTGGAACTTAATTTTTAATATAATAAAAAGAATTAAATATTAATGTAATGAAGCCACTGATTACAAAAAAAA
AATGGGCACGACAACATGACCCAAATATATATACTTACAGTACCTTATTAATATTCCGATACCAATGTG
>LE_HBa0242F12_SP6_403906 (trimmed for quality and cloning vector)
ACACCCGCTGTCTCTCAGTCCGGGACCCATGGAGGACATATCTGTCCATGCATCTATCGCAGCGCACGACACAACCCTCGATAATAATAACCATCACGGC
GCGCGATACGACCCTCGAAATATACATCCTTATACCACAATCATGTCTCAGATACAATGCAATTGACATGCTTAAATGAAAATGAGGAGATAACCATTTT
GATAACAAAGCACGATTTACAACCAGGAATACAACACCAACAAATAAGCAACAAGTCTCCAAGTCATTCTCAACACCACACAAAGAAATACACGAATTTC
ACACGCTTAACAAGGGTTTAGAAATCCACTTGCCTCAATCAATCCAGAACTCACTCTGGGACTTGAGTCTTTCCCTTTCGTTGAACTTCCAACTCAAAGC
AATCTATTCACATTAATAATCACAATAAGATTTCAAAACTAATAACACTCACCTTATTATGTGTTTAGCCTTGCACCAAAAATTTACTCAATTTTATATT
CAAGTTCGTAAATCATCATGCCAATTAACATTTTAACTATCATATTATTTTTTTTCAAATTTCAAGTCTAAGGTTTAATCTCAATATCACCAATTAAAAT
AATTTTATCACACAAATATATTGGAACTTAAT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.937446
Expected error %
0.0378622
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0242F12
Clone
Clone name
hba-242f12
LE_HBa0242F12
P242F12
Clone type
BAC
Contamination
none
Estimated length
89,679
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found