Clone Read LE_HBa0242G04_T7_403972

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0242G04_T7_403972
Primer
T7
ID from Seq. Facility
LE_HBa_242_G04-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
809 trimmed for vector and quality, 851 raw
Sequence
>LE_HBa0242G04_T7_403972 (raw untrimmed)
AGCGACGGGGTCTCTGAGTCGACTGCAGGCATGCAAGCTTCACCTTTTGGACTTCACCTTCAAATAATGTACTATGTATGGCATATGCAAAAACATGCGT
AAAGGGACATTTTAGTAAAATAACATTTCATGCAATTTAAGAAAAACATTCAAGAATATAAAAGCAAAACATCATAAGAATAATCATTTACCACTTAGAT
AAGAACTTTCATAATTTTAACCAAAAAAAGGCATTTATAGTAAACTCCCAAAAACATACAGTGAACTCAAATCTAACATTACAGTGAACTAATTAAGCCT
TTACAGTGAAACCATTTTAGCATTTACAATAGATCATTTAAAGCATTCACAATGAATTCAACTTGAGCAATTACAATGAACTATCCTACTCTAAATGAAT
GAACTTCCAAGGCCAAGCGAAAGAGAAAGTGAACTCATTTTCCATAAGAGTTTCCCTACCTCGGGATTATCCAAAGACTCACTAAGGTAAGACATGAAGA
AAGTATGCATATTCCTCCTTCAATACACACCAGAGAAATCCTCAAGACCACCCCTTTTGGCTTACTCAACTCGGGAAAACAAGCCCCTCAATCAATGGAA
AGACATTAAAAGACACCCAACAAACAACCAAAGTCTTCCCTTTCTGAATGACTACTTAGTGCAATGAGTAGATACCGTCCAATACCACCATCTACCTTAA
GTAGTAAATTCTTTTAGAAGGTTTGGCACCAAGTCTTCCCTTTCAGAAGGTCCTACCTAGTGCAATAAGTAGATAGCATCCCATAACACCACCTACCTTA
AATAGTACGTTATTTTATAAGACTTAGTTCAATCAATTATTTTGTGGAAGT
>LE_HBa0242G04_T7_403972 (trimmed for quality and cloning vector)
CTGCAGGCATGCAAGCTTCACCTTTTGGACTTCACCTTCAAATAATGTACTATGTATGGCATATGCAAAAACATGCGTAAAGGGACATTTTAGTAAAATA
ACATTTCATGCAATTTAAGAAAAACATTCAAGAATATAAAAGCAAAACATCATAAGAATAATCATTTACCACTTAGATAAGAACTTTCATAATTTTAACC
AAAAAAAGGCATTTATAGTAAACTCCCAAAAACATACAGTGAACTCAAATCTAACATTACAGTGAACTAATTAAGCCTTTACAGTGAAACCATTTTAGCA
TTTACAATAGATCATTTAAAGCATTCACAATGAATTCAACTTGAGCAATTACAATGAACTATCCTACTCTAAATGAATGAACTTCCAAGGCCAAGCGAAA
GAGAAAGTGAACTCATTTTCCATAAGAGTTTCCCTACCTCGGGATTATCCAAAGACTCACTAAGGTAAGACATGAAGAAAGTATGCATATTCCTCCTTCA
ATACACACCAGAGAAATCCTCAAGACCACCCCTTTTGGCTTACTCAACTCGGGAAAACAAGCCCCTCAATCAATGGAAAGACATTAAAAGACACCCAACA
AACAACCAAAGTCTTCCCTTTCTGAATGACTACTTAGTGCAATGAGTAGATACCGTCCAATACCACCATCTACCTTAAGTAGTAAATTCTTTTAGAAGGT
TTGGCACCAAGTCTTCCCTTTCAGAAGGTCCTACCTAGTGCAATAAGTAGATAGCATCCCATAACACCACCTACCTTAAATAGTACGTTATTTTATAAGA
CTTAGTTCA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.935879
Expected error %
0.0594911
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0242G04
Clone
Clone name
hba-242g4
LE_HBa0242G04
C12HBa0242G04
P242G04
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found