Clone Read LE_HBa0242H19_SP6_404127

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0242H19_SP6_404127
Primer
SP6
ID from Seq. Facility
LE_HBa_242_H19-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
403 trimmed for vector and quality, 774 raw
Sequence
>LE_HBa0242H19_SP6_404127 (raw untrimmed)
TTTTAGAGGGGTGTGATGAGATTCGGCAGGAAGGGGAAGCTCAGTCCAAGATACATTGGGCCTTATCAGATTGTTCGTAGGATAGGCAAGGTTGCCTATG
AGTTGGATCTACCATCTGATTTGGAGGCGGTACATCCAGTCTTCCATGTATCGATGCTACGTAAATGTATTGGTGATTCTTCTAGAGTATTCCCTGTAGA
TGATATTCAGGTAACAGAGGAGTTGTCATATGAGGAGAAACCCGTGGCTATACTTGTTCGTCAGGTTAGAAGGTTACGTACTAAGGATGTGGCTTCTGTC
TAAGTGTTGTGGAAAAATAACAATAGGGATGAGATGACTTGGGAAGCGGAAGACTAAATGAAGAATAAGTATCCTTACTTGTTCCCCGTACCTGCATGTA
ATTCAATTCCTAGCTTGACTATATTGATAGATAATGAGATTATGTAGCTGTGAGGCATCTATAATTTACTGAATGCAGGTTGATAGGTATAACTTTTTTA
TATACCTCGCTGGAATTTGTTTTTGCAAGACTCTAACTTTTACATTCTGATGATAATTGTTTCTATGGGGGGTAGGGTGTTTATGCCGTTTAATTTTCAT
TTATTTACTTATCTGTCTCTCTCTTTTTTTTATTTTCTTTTTTTATAACTTTCTGTATGGTTGTTTATTTTTCGACGTTTTCTTATATTTTTTATTTTTT
TCTAAATTTATTTTGTTCTTTATTTTTATGTGATTTCATTTTATTATTTACTTTATTTTCTATTTTTTTATTTC
>LE_HBa0242H19_SP6_404127 (trimmed for quality and cloning vector)
GATGAGATTCGGCAGGAAGGGGAAGCTCAGTCCAAGATACATTGGGCCTTATCAGATTGTTCGTAGGATAGGCAAGGTTGCCTATGAGTTGGATCTACCA
TCTGATTTGGAGGCGGTACATCCAGTCTTCCATGTATCGATGCTACGTAAATGTATTGGTGATTCTTCTAGAGTATTCCCTGTAGATGATATTCAGGTAA
CAGAGGAGTTGTCATATGAGGAGAAACCCGTGGCTATACTTGTTCGTCAGGTTAGAAGGTTACGTACTAAGGATGTGGCTTCTGTCTAAGTGTTGTGGAA
AAATAACAATAGGGATGAGATGACTTGGGAAGCGGAAGACTAAATGAAGAATAAGTATCCTTACTTGTTCCCCGTACCTGCATGTAATTCAATTCCTAGC
TTG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.970149
Expected error %
0.963318
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0242H19
Clone
Clone name
hba-242h19
LE_HBa0242H19
C06HBa0242H19
P242H19
Clone type
BAC
Contamination
none
Estimated length
98,250
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found