Clone Read LE_HBa0227N21_T7_404322

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0227N21_T7_404322
Primer
T7
ID from Seq. Facility
LE_HBa_227_N21-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
577 trimmed for vector and quality, 928 raw
Sequence
>LE_HBa0227N21_T7_404322 (raw untrimmed)
ACTCTAGAGTCGACTGCAGGCATGCAAGCTTAAAGATAGAATCTAACTGGAAATTGATATAAATTTGGTTAGTTGATTGACCAAAGATATCATACAGATT
GCTCGAGTTTCGGGCTTGGTATTTCAGCACTAGTACTGTGAGTAGTAATCTTACAACAATTGATATTTTATAACTTGCATGACTTTCACATGGTTTATAA
AGTAATTTGTTACCGAATATTTGAACTTGCATGTGGGACAAGTCTTTTACTTGATATTATACTGAAAAGATTAATCGAGATGATATCATTCTTACGAGGT
ATGATTACTATTGAAAAAGTTCTACACTTATTTGGAAAATAGTATTTTGACTGGTGATTGCTAAACTTTGAAATGATATTATTTGATAAGATTTAAATGT
TTTGTTCGATTTTGAATCGTTTCTACTAATTATAAGAAAAAAATAAACGGGACTAGACCTTATAGAATCCCGTAGCTAACGATAGGTATGCTAGACCTAG
TGCACCTTGTAATAACCAATCACTAATAAAACCCTTGCTATTGGAAAGGTAGAACTAGTATACCGTTACCGATACACATCGAGTAGGGATCTACTAAGTG
GCAAACCTAAGATTTTCGTTGAGGAGGATTGGAAAAATAAAAGTATCAACATCTAACTAAAAAAATTGAAAAAAAATTTGTAAAAAATAAAAAGACTACC
CAAGGATTCAAACCCTGGGACATCCCGCTTAACTTTGAGCTCAGCTACCGCTTGGGTTGTCACATCCCTTTGGTGGTTAAGGTGTTAAAGAGATTTTTTT
TATTTTAAACCCAAATCCTGAAAAATTTCACCTTAGGGTATCCAGTGTTATTTTTTTTTTTCTAGGGGTTTTCCGGGGGAAACCCCATGTAAAAAATCCT
TGTGGCCCCCCCCCCATTTATTTTATTG
>LE_HBa0227N21_T7_404322 (trimmed for quality and cloning vector)
CTGCAGGCATGCAAGCTTAAAGATAGAATCTAACTGGAAATTGATATAAATTTGGTTAGTTGATTGACCAAAGATATCATACAGATTGCTCGAGTTTCGG
GCTTGGTATTTCAGCACTAGTACTGTGAGTAGTAATCTTACAACAATTGATATTTTATAACTTGCATGACTTTCACATGGTTTATAAAGTAATTTGTTAC
CGAATATTTGAACTTGCATGTGGGACAAGTCTTTTACTTGATATTATACTGAAAAGATTAATCGAGATGATATCATTCTTACGAGGTATGATTACTATTG
AAAAAGTTCTACACTTATTTGGAAAATAGTATTTTGACTGGTGATTGCTAAACTTTGAAATGATATTATTTGATAAGATTTAAATGTTTTGTTCGATTTT
GAATCGTTTCTACTAATTATAAGAAAAAAATAAACGGGACTAGACCTTATAGAATCCCGTAGCTAACGATAGGTATGCTAGACCTAGTGCACCTTGTAAT
AACCAATCACTAATAAAACCCTTGCTATTGGAAAGGTAGAACTAGTATACCGTTACCGATACACATCGAGTAGGGAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.94197
Expected error %
0.526188
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0227N21
Clone
Clone name
hba-227n21
LE_HBa0227N21
P227N21
Clone type
BAC
Contamination
none
Estimated length
148,279
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found