Clone Read LE_HBa0230E11_T7_404964

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0230E11_T7_404964
Primer
T7
ID from Seq. Facility
LE_HBa_230_E11-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
70 trimmed for vector and quality, 894 raw
Sequence
>LE_HBa0230E11_T7_404964 (raw untrimmed)
GACTGCAGGCATGAAGCTTCTTCTCTAGGGTTAGACCTACTGCGATTAGGTAACCTCCCTTTACTGCTAGGATAGAAATGATTTAATTCATGGTCTAAGA
GGTATTTAATCAACTTGATTGATCTTGAGTAATAGACACTCATCTGACTCAGCACCTCCACGCTTTCCTTCATCGCTTCAAGCATTCTGTCTTGCTCATG
AAGCTTTAGAGAATGATCAATAGAGCCTCCTCGATACTTTAATCTTCGGTGCCCCTTGAATTTACTTCCCCATAAGGAGGCATGTCCCCCCCTGGGGTCT
TGCCCGGGTTTCCCTCCTCAAAAATTTTGGTGGTCAGTTCTCCCATTTGATTTCCCTTGGTATTATACTTGAGAAAACCCCCCCTTTTTTTTTATTACCC
CCGGCGAACTTGACCCTAATTTCCTTCCCTCCTTCCGCGGGTTTCCCCCCCCTACTTTTATTTTTCAAAAAACGGCTTCTCCCAAAGGGGGCAGTGTGTA
AAAATCCCCTCCATATAAAAATCATAATCCCCCTCCTTTACTCTTTTTTCCCCTATAAACCCCCCTCTTTTCGAGAAGGGGTGTATTTTTTATGTTTTTT
TATTACAACTCAACCCCTCTCCCCTCATCGGGGATTACTTTTCTTCAAATATCTTATTTTACCCACAAGGGGGGTGGGGTTTTCCCCTCAACAAGAGGGG
GGGGAAAAATTTTTCGGGGATAGATATATTCCTTTTTAAAAACCTGTTCCCTTATTTTTTTTAATAATAAACATTCTTTTAATTATCTAGTGGGGTGGTC
CCCAAAATCCTCTATACTGGGGGGTTCTTTCTCCCATCGACTTTAATTGGATTCCATCCAAGGGTCTTTCTTTTTCTGGGGAAATCTCGGTTAT
>LE_HBa0230E11_T7_404964 (trimmed for quality and cloning vector)
TTCTTCTCTAGGGTTAGACCTACTGCGATTAGGTAACCTCCCTTTACTGCTAGGATAGAAATGATTTAAT

This is probably not a useful sequence.

Problems:
  • Short cloning insert
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.873148
Expected error %
0.884799
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0230E11
Clone
Clone name
hba-230e11
LE_HBa0230E11
P230E11
Clone type
BAC
Contamination
none
Estimated length
88,985
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found