Clone Read LE_HBa0118E03_T7_40517

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0118E03_T7_40517
Primer
T7
ID from Seq. Facility
LE_HBa_118_E03-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
722 trimmed for vector and quality, 896 raw
Genbank Accession
Sequence
>LE_HBa0118E03_T7_40517 (raw untrimmed)
ATAACCCGGGTCCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGCAAATATTGTTTCAGACAATCCTTTGACTTACCTAATCAACATACA
AGACTACTAAACTCCCCTTTGCAACAAAATTAGGTGGTTGCTCCATATAGACTTCTTCACAATGGAGTGGTCATTGTAAGTGCTGAAAATCTATTATAAG
TATGTGGATCATGTTGGAATCATACTAAACAAGTCCAAGAAAAACTGGCCGAAACATACTCATCTGCCAGAGTATTAGTTTTGATGATTAAAAGTGGTCA
TAGTCTAAGAAATAAAATTATATGGGTAGGGTCAGAATGATGTCACGACCCAACTAGAAAATAGAAATTATATAATATAGTTCAAATTGATGGAACAACT
CCATTGAAAATGAGAAATAATATGGGTAGGGTCAGAATGATGGCAAGACCCTACTGAAAAAAGAAAAATTATATGGGTAGGGTTGGAATGATGGCACAGA
CCTACGTAAATCAGATTTGAAGAGTCACCGTAAAAAGGAATGGAACTATACAAATCAAATCTGAGTCATTGAAAAGACACATGATGCTATACTACTCAGA
TATGAGAAAATAGTTCAAAAAAAAAATCCACGATATTACACAAATTAAATATGAAAAGTAATCAGGAGAGATGCACTTTGCTACACAAATAAGATATGCT
TCCTTCGGGGTGGCGCAGTATTTTGAGCTTGGGACTTTCCATGTTGGAGTCTCAAGTTTGAAACCATTGCCAANCAAAAGCAATGAGTTTGCCTTCTGGG
GCCAGCTCGTCGCACCAGGCTTGCCCAATCGGTATACCAAATCGGGTTACCTCTTCTTAGTTGTTTTGCGAGCTTTTGCATAAGAGCGGGGTTTTT
>LE_HBa0118E03_T7_40517 (trimmed for quality and cloning vector)
AGCTTGCAAATATTGTTTCAGACAATCCTTTGACTTACCTAATCAACATACAAGACTACTAAACTCCCCTTTGCAACAAAATTAGGTGGTTGCTCCATAT
AGACTTCTTCACAATGGAGTGGTCATTGTAAGTGCTGAAAATCTATTATAAGTATGTGGATCATGTTGGAATCATACTAAACAAGTCCAAGAAAAACTGG
CCGAAACATACTCATCTGCCAGAGTATTAGTTTTGATGATTAAAAGTGGTCATAGTCTAAGAAATAAAATTATATGGGTAGGGTCAGAATGATGTCACGA
CCCAACTAGAAAATAGAAATTATATAATATAGTTCAAATTGATGGAACAACTCCATTGAAAATGAGAAATAATATGGGTAGGGTCAGAATGATGGCAAGA
CCCTACTGAAAAAAGAAAAATTATATGGGTAGGGTTGGAATGATGGCACAGACCTACGTAAATCAGATTTGAAGAGTCACCGTAAAAAGGAATGGAACTA
TACAAATCAAATCTGAGTCATTGAAAAGACACATGATGCTATACTACTCAGATATGAGAAAATAGTTCAAAAAAAAAATCCACGATATTACACAAATTAA
ATATGAAAAGTAATCAGGAGAGATGCACTTTGCTACACAAATAAGATATGCTTCCTTCGGGGTGGCGCAGTATTTTGAGCTTGGGACTTTCCATGTTGGA
GTCTCAAGTTTGAAACCATTGC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.947608
Expected error %
0.670174
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0118E03
Clone
Clone name
hba-118e3
LE_HBa0118E03
C12HBa0118E03
P118E03
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found