Clone Read LE_HBa0246E15_T7_405342

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0246E15_T7_405342
Primer
T7
ID from Seq. Facility
LE_HBa_246_E15-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
2 trimmed for vector and quality, 2845 raw
Sequence
>LE_HBa0246E15_T7_405342 (raw untrimmed)
GGAGAGCACTATCTCGCANGTGGNGAGGTGAGCTTGATATNCGCGTGTGTAGTCAGAGAGGTCGAGCATGCATTCACATATGCACANCACATGTGACTAT
TAGANACGATACAGTNATCTACACGATTGCGCAATAATGATGTTATGTTGAGAGAGCACTCTCNACTTATCTCTATTTGTACTGATAGTGTCTGTCTGAG
CAACTTGATAGATTGAAGTAATGTGTCTGCATCACTTGCCATAATTACATNATGTGACTCCTACTGTCAGTCGCTGTGCACACGGACCTGCCTCACCATC
CTATGATGATTTGGATGAGTGCGATACTGGTTGTCGGTGTGAAGATGGAAATGATGTGAGCGTGCTCTACACAATGNATATCGATTAGATATTAGTGTAG
TGTNGTATAACCTCTGTATTCGTACTANGCAGTTATAANGTGTTGCATTCAAACTATACACCAGCGGCGCAGTAGGACTGCTCTANTGCTCTATGATACA
TTAATGACATGTATGTTAGTCGAAGAGAATAACTNGCAGTGATATGTGTTNAGCGACCTCTGCCACGCTGAGATGGACTATAATATTAATACGTTATCGA
CATGTGATGATGCATTCGATGTCGCAGCAGATGATATGATGGACATAAGACTGTGCTGTAGTGACTACAAGCCACGCAATACCATGCGCTATCTCTGTAG
AGAATATGTGTGTGATATCACGATGACGATAGACCAATGCTCCANATTATAGACGTGATGACATGAGTGGAGAGCCTCAACTAAAGCTAAACAGTGTGAG
CTAGCTGAACATAGATGTAGTNTAAAATGCTTCTACTCTTCTGCTCGAGACGTATGATATCTACTTAAAGAACTGTCGTAGTTCATTAGGATGTAGAATA
GATTTATGATTGTGAATAGCAGAGATGTACGTGCATATCACTGAATGAGCGGTATGAGCATCAATGAATGTGGGATATACTCTGGCTACATATATCTCGA
GTAGTGTTGCATGGAGTATATATGGATTGACTTCGCAACGAATAATAGCAATGTTGAATGAATATTCGCTCGGTTTTGTAGATGCAGGTGTGTCCAATGT
GATCTGTCGATATNACNATTCATATGACTGCGAATGATCGGTACTACGTAGACTTGTCTATAGCGCATCAGTATATCGGATAGTCCGAGAGGCTCATCTC
ACTACATGATGGTGATTGTGTGACNATGCTGACTGGAGAAACTATCGGTGAGATGTGATGTAAGTCACAATATATATGACGNCATTGTATAGACGATGTA
GAGATATCGCACGAGCTAATGATGTCGATGATGTGAAAGATGAATAACACGACTAATGATACGAGACAGACTATATCTACTAGATGTGACGTGCGTAAGA
TATACTATACTGATGTGTGATACATATCTGATGGATNAGCAAGATGTCACCTTGATGTGACACAGTTTACTNATGCGATAGNGTACCTTATCTCATATGT
AAGACGCAAATGGTGTGATATACACGGATAGAATTNAGACTTGCAAGTATAGACACACTGTATGATGATCTACGCGTGGACAATACATGCTGCACGATGC
ACTNTATGAGCATCACCTGATACTGAACGGCATGAATGCGACTAGNGTTGTATGATGTATGCGATGANCGTGGATNGATATAGGTATCATAAATGTGTGC
ACTACANGAGTGNGATAGTTATCGTTAGCTGGTTGACATGATCATGTCACTAGTTGTAGTAATAATACGNAGCTATCTTGATGAGTCTATTAGCGGTGAT
GGATCACGATACTGATACTAACTTATACCGGCAGTGTCANGATACGTCTGNCATGAATCGACGTTCACGTAACTGGAGTAGTGCANGATGANACTTACTG
GANTATGAGACTNCAACAGAGACTGCTGNGCGATGAGCAATGACAGATAGTGATTGGATATGCTCTTACTGCTGATGATTATCAGTAATGAGGATTCCAT
ACTATGACAACA
TGTGTAGCTATGAGCATGAGACTATCTTGCTAGTGATGCGTACGTACGATACTCTATCCATGTGTCTGTTACGATTGATGTTATCCTG
NTNCTAGGTTGTGCGATGACANTAGACGATCGCTGCAAATGATTNATCACTGATGGATTAATCGACGTGNATGTTACGTGATTATTATGTACGATCGAGT
GACTCGTACGATAGTATAATTGATGCACTNACTGATGGCGTGCTGCGACTAATGATGCATGTNCTATGATATGGCTGACTAGATGCTAGACATGACTCTC
ACATACTCTGTATGATATAATGACTCAATATGTATGTATNTGTGTNANATGCTGGCGTCTGATGTATGCACATAGATTGTNCATGTCAGTGAAGTTGTGT
ATCATACGTAACTGNACATGCCGTATACGTNGATTGNGTCGNATGAGTGTGACATCTTATCTGCATGTNCGATNANGNACGCANATTGAGTGANTACATG
TAGATCGTATTGATGAGTGTATCGTGATATNCTATGACTGCGTAGTTATNTTCGTGATACGACTGACTCTATACACGTGATCGTGAGTACNANTGTTATG
AAGTGANGTGATGACGTGTGCANGATACTGCCGATGATGAGATAGAATGAGTAGTGAGTGTANACTGTATGANTACAGGGTTNACTNGTTAGCTTGCATA
TGAAATAATGTATGACGTGCGTCGCGTATACACTGCTCATGATGATGACTAGNGTTTAGTAAATNAGTAATACATGATGATGANCATGATTATGTTGCGT
ATCACTATACGTGCATCTNCGAGCGTNACGAATGATCGAGTCATG
>LE_HBa0246E15_T7_405342 (trimmed for quality and cloning vector)
TG

This is probably not a useful sequence.

Problems:
  • High predicted error rate
  • Low complexity
  • Short cloning insert
Warnings:
  • Not screened for contaminants
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
not recorded
Expected error %
8.32163
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0246E15
Clone
Clone name
hba-246e15
LE_HBa0246E15
C06HBa0246E15
P246E15
Clone type
BAC
Contamination
none
Estimated length
74,091
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found