Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Clone Read LE_HBa0118E13_T7_40537

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0118E13_T7_40537
Primer
T7
ID from Seq. Facility
LE_HBa_118_E13-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
615 trimmed for vector and quality, 885 raw
Genbank Accession
Sequence
>LE_HBa0118E13_T7_40537 (raw untrimmed)
TTGACCCGGGTCCGGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCTATTGGATTTTGACAGAGTCCTTTTAGAGGGAGGGTTTTGGATTTTT
GAAAAATGAAGTCTCCTTTAAGGTCTTAGTATTTGAACCGTATTAATATACCTAAAATACCCAAAAATAATCATCCATGGTTCATGAAGTCACTTGAAGT
GAATTTACCAAACACCTCAAGCGTTGGCAGATTTTTGTGCAGCTTTTACGGGCACCAGTGACGCCCCTCTAGTGACCGGCCGTTACCCAGTCGACACCCC
TTAGATGTGGTCCATAGATTGGGTCTGAGCCTCCATGTTGTGCGGACTTTTCTTGACTTGGTGGGAAAATCTATGCCCAAGGTCGACGGGCCATCGTTTG
ACCAACGGTTCGTCCCCTGTGGCCGTCGTTGGTCACTGCTTGGCAGCATCCTGCCAAAGGGATGGGTTCCTCTTCTAGGGCCCCTTGTGGGTCCTAGGTG
GGGTTGTACCCGGACTTTAAATGACTATACATAGTCGTATAAGTCTTACGAACATCCCACATCAGTTTCAATCAAAACGAACATGTAAAACTCGCTAAAA
CACACGAGGACACACAAACACTTTTTAAGACATACCTTTCGAACCCCATGGACGTTCTCGGACGTTTGACCTCCAAAAATCCACAAATTTCATTCCCTTC
CCAAGGACATCTTTATAAACCATTTTAACATAAAATTAACTCATGGATCATTTACAAATCCTCAGTTCACCTTAGTTTTTTTTAAGGGTGTAACACTTTT
AAACCTCTTTATTTATCATAAATAAAAATTTAATGGTTGATTTATCACATTGTATTCCCCCCAACAAACGTGGTTGATTCGATAT
>LE_HBa0118E13_T7_40537 (trimmed for quality and cloning vector)
TAGAGTCGACCTGCAGGCATGCAAGCTTCTATTGGATTTTGACAGAGTCCTTTTAGAGGGAGGGTTTTGGATTTTTGAAAAATGAAGTCTCCTTTAAGGT
CTTAGTATTTGAACCGTATTAATATACCTAAAATACCCAAAAATAATCATCCATGGTTCATGAAGTCACTTGAAGTGAATTTACCAAACACCTCAAGCGT
TGGCAGATTTTTGTGCAGCTTTTACGGGCACCAGTGACGCCCCTCTAGTGACCGGCCGTTACCCAGTCGACACCCCTTAGATGTGGTCCATAGATTGGGT
CTGAGCCTCCATGTTGTGCGGACTTTTCTTGACTTGGTGGGAAAATCTATGCCCAAGGTCGACGGGCCATCGTTTGACCAACGGTTCGTCCCCTGTGGCC
GTCGTTGGTCACTGCTTGGCAGCATCCTGCCAAAGGGATGGGTTCCTCTTCTAGGGCCCCTTGTGGGTCCTAGGTGGGGTTGTACCCGGACTTTAAATGA
CTATACATAGTCGTATAAGTCTTACGAACATCCCACATCAGTTTCAATCAAAACGAACATGTAAAACTCGCTAAAACACACGAGGACACACAAACACTTT
TTAAGACATACCTTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.985172
Expected error %
0.48583
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0118E13
Clone
Clone name
hba-118e13
LE_HBa0118E13
P118E13
Clone type
BAC
Contamination
none
Estimated length
111,901
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found