Clone Read LE_HBa0118F10_SP6_40578

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0118F10_SP6_40578
Primer
SP6
ID from Seq. Facility
LE_HBa_118_F10-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
502 trimmed for vector and quality, 848 raw
Genbank Accession
Sequence
>LE_HBa0118F10_SP6_40578 (raw untrimmed)
GCCGGGGGTTTTAGGGGGGTGGGTTTCGAACTGGGGACTTGGCTGTGAAGCATCCAGATGGTTACATCGAATTGACCCCTTTTGCTGAGGACATCATTAT
ATCCGGTGGAGAAAACATTCTTTCAATCGAGGTGGAGTCGGTTTTATTCAGCCATCCATCTATTCTTGACGCTGCTGTAGTAGGAAGACCAGATGATTAC
TGGGGTGAGACACCTTGTGCCTTTGTAAAACTAAAGGATGGTAACAATGCAACTATGGATGAAATCATCAAGTATTGTCGTGATCGTTTACCACATTACA
TGGCTCCGAAAACAGTAATTTTCGATGATTTGCCCAAAACATCTACAGGAAAGACACAAAAATTTGTTTTGAGACAGAGGGCCAAAGCTATGGGGAGTAT
TACAAAGCCAGCTAGCAAACTATAATTTGTAATTTCCTGTGTTGTATTGTGGATAGACTGATAAAAAGTCTGGCAAGGCAAGTTGAGGGTCGATCAGAAA
CAACCTCTCTATCTCTACGAGGTTGGGGTAACTTCCGTGTATACTCTACCCTCTCTCGACCCTTCATTGTATTTTGTTATCGTGGATCGACTGATCGATG
TTTTATTTTATTGAATCCTATTTATGTTATAGGTATTGCAAAATTACTATTTTTTTAATTTTATATCTATGTTGAATGATATTGTTGTTTGAGTGTTTAT
GGGCTTGTTTATTTTTGTTTGTTTTTATAGCAATACTGATTGGTGAGGTTGCTGACGTTGCTGCTTGTTGTTAGTATTTTTATTTTCTTTCTTTTTGTTT
TTTTGTTGTTCGGGTNTTGTGTTTATATTTGTCTTCCATACTTATTTT
>LE_HBa0118F10_SP6_40578 (trimmed for quality and cloning vector)
GGGGACTTGGCTGTGAAGCATCCAGATGGTTACATCGAATTGACCCCTTTTGCTGAGGACATCATTATATCCGGTGGAGAAAACATTCTTTCAATCGAGG
TGGAGTCGGTTTTATTCAGCCATCCATCTATTCTTGACGCTGCTGTAGTAGGAAGACCAGATGATTACTGGGGTGAGACACCTTGTGCCTTTGTAAAACT
AAAGGATGGTAACAATGCAACTATGGATGAAATCATCAAGTATTGTCGTGATCGTTTACCACATTACATGGCTCCGAAAACAGTAATTTTCGATGATTTG
CCCAAAACATCTACAGGAAAGACACAAAAATTTGTTTTGAGACAGAGGGCCAAAGCTATGGGGAGTATTACAAAGCCAGCTAGCAAACTATAATTTGTAA
TTTCCTGTGTTGTATTGTGGATAGACTGATAAAAAGTCTGGCAAGGCAAGTTGAGGGTCGATCAGAAACAACCTCTCTATCTCTACGAGGTTGGGGTAAC
TT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.972976
Expected error %
0.469588
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g20560.1 Score 198 E Value 1e-51 Identity 24.30% Align. Length 374bp (74.50%) Frame 2
68414.m02563 AMP-dependent synthetase and ligase family protein similar to AMP-binding protein GI:1903034 from [Brassica napus]; contains Pfam AMP-binding domain PF00501; identical to adenosine monophosphate binding protein 1 AMPBP1 (AMPBP1) GI:20799710
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g17650.1 Score 172 E Value 7e-44 Identity 21.70% Align. Length 368bp (73.31%) Frame 2
68415.m02042 AMP-dependent synthetase and ligase family protein similar to AMP-binding protein GI:1903034 from [Brassica napus]; contains Pfam AMP-binding domain PF00501; identical to cDNA adenosine monophosphate binding protein 2 AMPBP2 (AMPBP2) GI:20799712
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAN05507.1| Score 219 E Value 2e-56 Identity 26.80% Align. Length 383bp (76.29%) Frame 2
Putative AMP-binding protein [Oryza sativa (japonica cultivar-group)]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAL77740.1| Score 198 E Value 4e-50 Identity 24.30% Align. Length 374bp (74.50%) Frame 2
At1g20560/F2D10_4 [Arabidopsis thaliana] gb|AAK50082.1| At1g20560/F2D10_4 [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0118F10
Clone
Clone name
hba-118f10
LE_HBa0118F10
P118F10
Clone type
BAC
Contamination
none
Estimated length
93,824
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found