Clone Read LE_HBa0118F10_T7_40579

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0118F10_T7_40579
Primer
T7
ID from Seq. Facility
LE_HBa_118_F10-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
521 trimmed for vector and quality, 916 raw
Genbank Accession
Sequence
>LE_HBa0118F10_T7_40579 (raw untrimmed)
TTGGACTGGGTCCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTATCAAAGAAGAGGTTTCTGATTTCCTTGAGAAGATTCTGAAGAACAG
AGGTCTCATTGTTGTGACCTCTCCCAAGAAACCAGTTGAGAGCAAGTCATTGACAACTGATAAAATAGTTGTAGGTTTTGAGGAGGAGACAAAATGGATA
CTTAGAAAGCTCACTAGTGGACCTACAGATCTAGATGTCATTTCGATCACTGGTATGCCGGGTTCAGGTAAAACTACTTTGGCATACAAAGTATACAATG
ATAAATCAGTTTCTAGCCATTTCGACCTTCATGCATGGTGCACGGTCGACCAAGGATGTGATGAGAAGAAGTTGTTGAATAAAATTTTCAAACAAGTTAG
TGACTCAGATTCAAATTTTTTTGAGGATATTGATGTTGCTGATAAGCTACGGAAACAACTGTATGGAAAGAGGTATCTTATTGTCTTAGATGACGTGTGG
GATACAACTACTTGGGATGAGTTGACGAGACCTTTTTCCTGAATCTAACATAGGAAGTATGACGATTTTGACGACTCGAGAAAAGGAATAGGATTTGTAT
GTAAAGCTGTAAACTAGTACCATCTTTACCTTGTTTTTTTATATTTTTTTTTATTTGGTTTTTTTTTATTATTGTCTATTCTGTTGAGCAGCGTTGTCAT
TCATAATTATTAGATGATGTAGATTAAAACACCATATTTAATAAGTTTTATCTCAAATACAAAGTGTCCGTTATGATGCCACGAGTCATTTCAATACTTT
TCTCTTTAATACTTATATTTTTGTTTTATTTTATTGTTTATTTCTTAACGCCTTTCTTTCATCGTCCACTTCCTCTTATTCACCTCTCTCGTTCCTTCTT
CCATATATTTATTTGT
>LE_HBa0118F10_T7_40579 (trimmed for quality and cloning vector)
AGCTTATCAAAGAAGAGGTTTCTGATTTCCTTGAGAAGATTCTGAAGAACAGAGGTCTCATTGTTGTGACCTCTCCCAAGAAACCAGTTGAGAGCAAGTC
ATTGACAACTGATAAAATAGTTGTAGGTTTTGAGGAGGAGACAAAATGGATACTTAGAAAGCTCACTAGTGGACCTACAGATCTAGATGTCATTTCGATC
ACTGGTATGCCGGGTTCAGGTAAAACTACTTTGGCATACAAAGTATACAATGATAAATCAGTTTCTAGCCATTTCGACCTTCATGCATGGTGCACGGTCG
ACCAAGGATGTGATGAGAAGAAGTTGTTGAATAAAATTTTCAAACAAGTTAGTGACTCAGATTCAAATTTTTTTGAGGATATTGATGTTGCTGATAAGCT
ACGGAAACAACTGTATGGAAAGAGGTATCTTATTGTCTTAGATGACGTGTGGGATACAACTACTTGGGATGAGTTGACGAGACCTTTTTCCTGAATCTAA
CATAGGAAGTATGACGATTTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.95825
Expected error %
1.36414
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g50180.1 Score 67 E Value 7e-12 Identity 10.50% Align. Length 428bp (82.15%) Frame 1
68414.m05627 disease resistance protein (CC-NBS-LRR class), putative domain signature CC-NBS-LRR exists, suggestive of a disease resistance protein.
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g14470.1 Score 64 E Value 6e-11 Identity 10.50% Align. Length 407bp (78.12%) Frame 1
68416.m01833 disease resistance protein (NBS-LRR class), putative domain signature NBS-LRR exists, suggestive of a disease resistance protein.
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAC67237.1| Score 237 E Value 1e-61 Identity 25.50% Align. Length 485bp (93.09%) Frame 1
plant resistance protein [Lycopersicon esculentum] pir||T06267 nematodes resistance protein Mi-1.1 - tomato
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAC32253.1| Score 237 E Value 1e-61 Identity 25.50% Align. Length 485bp (93.09%) Frame 1
disease resistance gene homolog Mi-copy1 [Lycopersicon esculentum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0118F10
Clone
Clone name
hba-118f10
LE_HBa0118F10
P118F10
Clone type
BAC
Contamination
none
Estimated length
93,824
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found